We narrowed to 60,599 results for: tra
-
Plasmid#209292PurposeExpresses R2Bm-Cas9(H840A) fusion in E. coliDepositorInsertR2
TagsHis, MBP, SpCas9(H840A), StrepII, and bdSUMOExpressionBacterialPromoterT7Available SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCHOP10(dLZ).pCDNA1
Plasmid#21900DepositorInsertCHOP10 (Ddit3 Mouse)
ExpressionMammalianMutationThe coding region of the murine CHOP-10 cDNA was …Available SinceOct. 8, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSB115 - pL2_pSB90_fLUC-I_tGFP-I
Plasmid#123190Purposebinary plant vector for transient tGFP (with intron) and fLUC (with intron) expressionDepositorInsert2x35S::tGFP-I::tNOS 2x35S::fLUC-I::tNOS
UseLuciferaseExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
MO70 - Orai1 EC-Flag
Plasmid#79590PurposeTransient expression and retroviral ExpressionDepositorInsertOrai1 (ORAI1 Human)
UseRetroviralTagsFLAG (inserted between TM3 and TM4 of the protein…ExpressionMammalianPromoterCMVAvailable SinceAug. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
NET50 pmRFP-N2 (489)
Plasmid#61983Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
NET97 pmRFP-N2 (641)
Plasmid#61994Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSB96 - pL2_pSB90_2x35S::fLUC-I::tNOS
Plasmid#123188Purposebinary plant vector for transient fLUC (with intron) expressionDepositorInsert2x35S::fLUC-I::tNOS and VirGN54D in the vector backbone
UseLuciferaseExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF1304
Plasmid#144293PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCLASP_Crz1(19A)_CLASP_RGS2membrane
Plasmid#133085PurposePlasmid contains Crz1* with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-Crz1*-yeLANS). CLASP modulates nuclear localization of Crz1* in response to blue light.DepositorInsertCrz1*-CLASP
ExpressionBacterial and YeastPromoterpADH1Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
NET37 pmRFP-N2 (450)
Plasmid#61980Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NES-tdTomato-LINuS-WPRE
Plasmid#159894PurposeAAV expression of tdTomato fused to LINuS, a light-inducible nuclear localization signalDepositorInsertNES-tdTomato-LINuS
UseAAVExpressionMammalianPromoterEF1α promoterAvailable SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
TAPBPL pEGFP-C3 (1765)
Plasmid#62055Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-V5-Mfsd10
Plasmid#120238PurposeExpresses V5-tagged Mfsd10 in lentiviral vectorDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-VSVG-mScar3-10xSunTag
Plasmid#240630PurposeExpresses VSV-G, C-terminally fused to mScarlet3 and 10 repeats of the SunTag (GCN4) peptide, to luminally tag VSV-G-induced extracellular vesicles for use in EV-FUSIM assay.DepositorInsertVSVG-mScarlet3-10xSunTag
TagsmScarlet3 and 10xSunTagExpressionMammalianPromoterCMVAvailable SinceMarch 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Pur-ottlr3
Plasmid#225641PurposeExpresses the Oncorhynchus tshawytscha toll-like receptor 3DepositorInsertToll-like receptor 3 (tlr3 Oncorhynchus tshawytscha)
ExpressionMammalianAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-hDLXI56i-minBG-CI-EGFP-W3SL-BC(p1-10)
Plasmid#231360PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from the minBG promoter with hDLXI56i enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-mscRE4-minBG-CI-EGFP-W3SL-BC(p1-10)
Plasmid#231361PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from the minBG promoter with mscRE4 enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-Ple155-CI-EGFP-W3SL-BC(p1-10)
Plasmid#231351PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from Ple155 element, active in Purkinje cells.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-CMVe-SCP1-TagBFP2-W3SL-BC(p1-10)
Plasmid#231354PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses TagBFP from SCP1 promoter and CMV enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only