We narrowed to 26,950 results for: GFP
-
Plasmid#195495PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the core endoderm distal enhancer of human SOX17DepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only
-
C-SWAT GFP
Plasmid#182510PurposeC-SWAT compatible vector for C-terminal tagging with GFPDepositorInsertGFP
TagsGFPExpressionYeastAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFPV25.1_dGFPmut3-LVA
Plasmid#187378PurposerpsM promoter driving the expression of destabilized GFPmut3 (containing a LVA C-terminal tail)DepositorInsertdGFPmut3_LVA
TagsLVAExpressionBacterialMutationC-terminal LVA tailAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRnc-gGFP129
Plasmid#189537PurposeExpresses E. Coli RNase III under control of pBAD promoter and constitutively expresses gUTR-129-GFPDepositorInsertsRNase III
gUTR-129-GFP
ExpressionBacterialMutationN/APromoterJ23119 and pBADAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_GFP11-14-SEPT7
Plasmid#180342Purposemammalian expression of human SEPT7 fused to GFP11DepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1-14-GFP11
Plasmid#180344Purposemammalian expression of human SEPT9_i1 fused to GFP11DepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i3-14-GFP10
Plasmid#180345Purposemammalian expression of human SEPT9_i3 fused to GFP10DepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i3-14-GFP11
Plasmid#180346Purposemammalian expression of human SEPT9_i3 fused to GFP11DepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
W118-1_eGFP
Plasmid#180379Purposelentiviral transduction of eGFP geneDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSV40_mD6Ertd527e-HA-EGFP
Plasmid#192223PurposeExpresses murine mD6Ertd527e gene, C-terminally tagged with HA and EGFP, in mammalian cellsDepositorAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWPT-mEGFP
Plasmid#190606PurposeObtained by creating a deletion inside the mCherry coding sequence in pWPT-/GCCACC-mEGFP-IRES-mCherry (Addgene #49235)DepositorInsertsmEGFP
mCherry
UseLentiviralMutationa deletion was created in mCherry CDS impairing i…PromoterEIF1-shortAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
p09008_AF1-4+GFP5-7
Plasmid#173715PurposePlasmid backbone for the HyperXpress workflow containing new to nature hybrid GFP with strong fluorescence in E. coli cell free protein synthesis extracts.DepositorInsertshybrid GFP
mKate2
UseE. coli cell free protein synthesis extractsExpressionBacterialAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7-10-QUAS-GFP_ColE1
Plasmid#171657PurposeQUAS ten base pairs downstream of a T7 promoter. Expresses GFP in BL21(DE3) E. coli. Contains ColE1 origin of replication.DepositorInsertT7-10-QUAS
TagsssrA degradation tag (DAS+4)ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7-15-QUAS-GFP_ColE1
Plasmid#171658PurposeQUAS fifteen base pairs downstream of a T7 promoter. Expresses GFP in BL21(DE3) E. coli. Contains ColE1 origin of replication.DepositorInsertT7-15-QUAS
TagsssrA degradation tag (DAS+4)ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7-0-QUAS-GFP_ColE1
Plasmid#171650PurposeQUAS directly downstream of a T7 promoter. Expresses GFP in BL21(DE3) E. coli. Contains ColE1 origin of replication.DepositorInsertT7-0-QUAS
TagsssrA degradation tag (DAS+4)ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7-5-QUAS-GFP_ColE1
Plasmid#171656PurposeQUAS five base pairs downstream of a T7 promoter. Expresses GFP in BL21(DE3) E. coli. Contains ColE1 origin of replication.DepositorInsertT7-5-QUAS
TagsssrA degradation tag (DAS+4)ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-SpGalpha-i
Plasmid#185568Purposeto see protein dynamicsDepositorInsertGalpha-i
UseIn vitro transcription (mrna synthesis)TagsGFP, S-TagAvailable SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
phABCA3-eGFP_CRISPR_Donor
Plasmid#188540PurposeHomologous recombination donor plasmid for CRISPR/Cas9 targeting of GFP fusion protein to the stop codon of endogenous human ABCA3 gene locusDepositorInsertEGFP
UseCRISPR; Donor for homologous recombinationAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only