We narrowed to 167,150 results for: addgene
-
Plasmid#62436PurposeMXS_chaining vector with PGK::HygroR-bGHpADepositorInsertresistance cassette against hygromycin B with PGK Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAG306-GPD-VPH2 chr I
Plasmid#41897PurposeYeast expression of VPH2.DepositorAvailable SinceFeb. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
rtTA and TagBFP cassettes
Plasmid#62452PurposeMXS_chaining vector with 2 cassettesDepositorInsertsCMV::NLS-TagBFPx3-bGHpA
CMV::rtTA3-bGHpA
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
MXS_PGK::tTA2-bGHpA
Plasmid#62448PurposeMXS_chaining vector with PGK::tTA2-bGHpADepositorInsertcassette containing the tetracycline transactivator with PGK promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::HygroR-bGHpA
Plasmid#62435PurposeMXS_chaining vector with CMV::HygroR-bGHpADepositorInsertresistance cassette against hygromycin B with CMV Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
lag-2 promoter:GFP (pJK590)
Plasmid#26814DepositorInsertlag-2 promoter
TagsGFPExpressionWormAvailable SinceDec. 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pOTTC533 - pAAV SYN1 eGFP-2A-mKv1.2
Plasmid#75295PurposeAn AAV packaging vector that expresses eGFP and Kv1.2 under the control of a neuronal promoter.DepositorAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
MXS_PGK::CreERT2-bGHpA
Plasmid#62444PurposeMXS_chaining vector with PGK::CreERT2-bGHpADepositorInsertcassette containing the tamoxifen inducible Cre recombinase with PGK Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-Stuffer-HepmTurquoise2
Plasmid#192826PurposeContains stuffer sequence into which sgRNAs can be cloned and expresses mTurquoise2 from hepatocyte-specific promoterDepositorInsertmTurquoise2
UseCRISPR and LentiviralExpressionMammalianPromoterHepatocyte-specific promoter (HS-CRM8-TTRmin modu…Available SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only