We narrowed to 5,122 results for: NOG
-
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a-His6-UROD
Plasmid#236739PurposeProtein overexpression of human uroporphyrinogen decarboxylaseDepositorAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a-His6-UROD-N367A
Plasmid#236740PurposeProtein overexpression of human uroporphyrinogen decarboxylase N367ADepositorInsertUroporphyrinogen decarboxylase human N367A (UROD Human)
TagsHis6ExpressionBacterialMutationN367AAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR_CG6867_nostop
Plasmid#240238PurposeGateway entry clone with CG6867 without stop codonDepositorInsertCG6867 (CG6867 Fly)
UseGateway shuttle vectorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
TadA-8e-eIscBn-C-HMG-D
Plasmid#227145PurposeVector encoding human codon-optimized enhanced-activity nOgeuIscB fusion with TadA8e and HMG-D domain in C terminus driven by CMV promoterDepositorInsertbpNLS-TadA-8e-linker-nOgeuIscB-v3-linker-HMG-D-bpNLS
MutationD96R/E84R/V159R/H339APromoterCMVAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
hA3A*-IscBn
Plasmid#227146PurposeVector encoding human codon-optimized nOgeuIscB fusion with two copies of UGI and hA3A* variant driven by CMV promoterDepositorInsertbpNLS-hA3A*-linker-nOgeuIscB-nucleoplasmin NLS-2XUGI-bpNLS
MutationD96R/E84R/V159R/H339APromoterCMVAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
TadA-8e-eIscBn-N-HMG-D
Plasmid#227143PurposeVector encoding human codon-optimized enhanced-activity nOgeuIscB fusion with TadA8e and HMG-D domain in N terminus driven by CMV promoterDepositorInsertbpNLS-HMG-D-linker-TadA-8e-linker-nOgeuIscB-v3-bpNLS
MutationD96R/E84R/V159R/H339APromoterCMVAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHC025 (∆CBBp)
Plasmid#226203PurposeElectroporation knockout plasmid (pK18sB) to delete the C. necator megaplasmid copy of the CBB operon (deltaCBBp).DepositorInsertHomology arms for megaplasmid copy of the CBB operonthe CBB operon (deltaCBBp).
UseSynthetic BiologyMutation∆cbbR ∆cbbLpSpXpYpEpFpPpTpZpGpKpApAvailable SinceNov. 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAc5.1-PH-mCherry-Oskar 139-240 MUT (A162E/L228E) (HK202)
Plasmid#206464PurposeOskar 139-240 mut expression in Schneider cells for imagingDepositorAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBS-KDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-1XALFA
Plasmid#217509PurposeKD Recombinase dependent conditional 1X ALFA cassetteDepositorInsertKDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-1XALFA
TagsALFA tagExpressionInsectAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-deltaExon17
Plasmid#209563PurposeMammalian expression of Shtn1 long isoform with E17 deletionDepositorInsertShtn1 long isoform with E17 deletion (4930506M07Rik Mouse)
ExpressionMammalianMutationExon17 deletionAvailable SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-SHTN1LRRR>GGG
Plasmid#209562PurposeMammalian expression of Shtn1 long isoform with RG mutationDepositorInsertShtn1 long isoform with RG mutation (4930506M07Rik Mouse)
ExpressionMammalianMutationRRR to GGGAvailable SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-deltaExon16-17
Plasmid#209564PurposeMammalian expression of Shtn1 long isoform with E16-17 deletionDepositorInsertShtn1 long isoform with E16-17 deletion (4930506M07Rik Mouse)
ExpressionMammalianMutationExon16 and 17 deletionAvailable SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-deltaExon15-II
Plasmid#209566PurposeMammalian expression of Shtn1 long isoform with E15 deletion IIDepositorInsertShtn1 long isoform with E15 deletion II (4930506M07Rik Mouse)
ExpressionMammalianMutationExon15 deletion IIAvailable SinceMarch 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS7 puro
Plasmid#208405PurposeExpresses FLAG-tagged Drosophila IntS7 from inducible MtnA promoterDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS13 puro
Plasmid#208406PurposeExpresses FLAG-tagged Drosophila IntS13 from inducible MtnA promoterDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS14 puro
Plasmid#208407PurposeExpresses FLAG-tagged Drosophila IntS14 from inducible MtnA promoterDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only