We narrowed to 112 results for: NOG
-
TypeProtocol...several micrograms of target DNA from just a few nanograms of template DNA through several cycles of denaturation...
-
Predicting Adverse Reactions to Monoclonal Antibody Drugs
TypeBlog Post...relative immunogenicity score (Mattei et.al., 2022). Figure 1: Generation of immunogenicity scores...prediction of drug immunogenicity The goal of in vitro prediction of immunogenicity is to validate the.... Antibodies administered as drugs are still immunogenic, meaning that they elicit an immune response ...the body. Several factors contribute to the immunogenicity of a drug, including the product origin; purity...dose (Lu et.al., 2020). Evaluating a drug’s immunogenicity in-vitro helps researchers understand a drug...However, in silico and in vitro assessment of immunogenicity can help evaluate risk of an antibody. In...commercially available algorithm to evaluate the immunogenicity of therapeutics in silico. These algorithms... -
CRISPR Between the Genes: How to Experiment with Enhancers and Epigenomics
TypeBlog Post...to identify the critical NANOG binding sites: 1. Find Enhancers that have NANOG binding sites 2. Design...ChIP-seq experiment (think “GPS for proteins”) for NANOG, an essential transcription factor in embryonic ... just over 13,000 significant binding peaks for NANOG in the human genome. But not all of those 13,000...Design a CRISPR screen to target and disrupt the NANOG enhancers 3. CRISPR out the enhancers from step 2. ... ESCs die or differentiate Step 3 reveals which NANOG-related genes are critical to stem cell survival...CRISPR in the next section. In order to denote the NANOG enhancers from step 1 with genome math, we’ll need...shorthand from the field of epigenomics: H3 – one of NANOG’s associated histone proteins K4 and K27 – locations... -
Immunology Research Plasmids and Resources
TypeCollection...IGKJ1 immunoglobulin kappa joining 1 J1 IGKJ2 immunoglobulin kappa joining 2 J2 IGKJ3 immunoglobulin kappa...IGKJ4 immunoglobulin kappa joining 4 J4 IGKJ5 immunoglobulin kappa joining 5 J5 IGKV@ immunoglobulin kappa...CD79a molecule, immunoglobulin-associated alpha IGA, MB-1 CD79B CD79b molecule, immunoglobulin-associated ...MGC102857 IGHA2 immunoglobulin heavy constant alpha 2 (A2m marker) - IGHD immunoglobulin heavy constant...MGC29633 IGHD@ immunoglobulin heavy diversity group IGD1, IGHDY1 IGHD1-1 immunoglobulin heavy diversity...IGHD1-14 immunoglobulin heavy diversity 1-14 (non-functional) DM2, IGHD114 IGHD1-20 immunoglobulin heavy ... IGHD120 IGHD1-26 immunoglobulin heavy diversity 1-26 IGHD126 IGHD1-7 immunoglobulin heavy diversity 1... -
Viral Vectors 101: Viruses as Biological Tools
TypeBlog Post...the brain. Secondly, some viruses have a low immunogenicity which makes them ideal for applications with...primary advantage over adenovirus is their low immunogenicity, which means they do not stimulate a strong...attractive tool for human subject delivery, as immunogenicity was previously a large barrier for gene therapy...Tropism Only Infects Dividing Cells Moderate Immunogenicity Insertional Mutagenesis Possible Lentivirus...Efficiency Transient Gene Expression High Immunogenecity AAV Remains Episomal (Little Risk ...Risk of Mutagenesis) Very Low Immunogenicity Infects Non-Dividing Cells Transient Gene Expression Low... -
Antibodies 101: Immunoprecipitation
TypeBlog Post...Immunoprecipitation (IP) uses immobilized antibodies, or immunoglobulins, to isolate a specific protein out of a complex...proteins bind only to the Fc portion of the immunoglobulin, leaving the antigen binding sites free to ...Protein A and Protein G have an affinity for immunoglobulins, the strength of the interaction varies between...will bind both the primary antibody and serum immunoglobulins indiscriminately, causing competition for binding...its use as an immunosorbent for isolation of immunoglobulins. FEBS Letters 28:73–76 Additional resources... -
Viral Vectors 101: Types of viruses
TypeBlog Post...retroviruses generally have moderate to high immunogenicity, meaning they induce an immune response in ...along with the endogenous DNA. AAV also has low immunogenicity, meaning it does not induce the same high immune...identified so far! Adenovirus generally has high immunogenicity, but some strains have been engineered to induce...too. May your titer always be high and your immunogenicity low! References and Resources References Robinson... -
Antibodies 101: Polyclonal Antibodies
TypeBlog Post... are generated by injecting an animal with an immunogen, then isolating and purifying the antibodies produced...such as a rabbit or a goat) is injected with an immunogen. This might be the full-length protein that you...present in the serum, whether specific to the immunogen or not, while any other proteins pass through....antibodies produced by an animal are specific for the immunogen. A different type of purification can be performed... -
Antibodies 101: Introduction to Antibodies
TypeBlog Post... is an antibody? Antibodies, also known as immunoglobulins, are ~150 kDa, Y-shaped proteins that are both..., and the Fc, or crystallizable region. Two immunoglobulin (Ig) heavy chains and two Ig light chains make...antibodies, which come from naturally-occurring immunoglobulin genes, recombinant antibodies are plasmid-based...Geziena MT, Steven GE, Lorna J. (2004) ANTIGENS, IMMUNOGENS, VACCINES, AND IMMUNIZATION. In: Immunology Guidebook... -
Plasmids 101: Antibiotic Resistance Genes
TypeBlog Post...Action* Working Concentration** Kanamycin aminoglycoside Binds 30S ribosomal subunit; causes mis-translation...mis-translation Bactericidal 50-100 ug/mL Spectinomycin aminoglycoside Binds 30S ribosomal subunit; interrupts protein... Bactericidal 7.5-50 ug/mL Streptomycin aminoglycoside Inhibits initiation of protein synthesis ... -
Viral Vectors 101: Viral Applications
TypeBlog Post... addition to antibody response 2) very high immunogenicity 3) and long-lasting immune response even after... gene therapy. The tractability of AAV, low immunogenicity, and cell-specific targeting features make ...Cunningham AL, Churchill MJ. Pathogenicity and immunogenicity of attenuated, nef-deleted HIV-1 strains in... -
Hot Plasmids - March 2020 - base editors, GEVI, MoClo, and optogenetics
TypeBlog Post...Alistair McCormick’s lab recently developed the CyanoGate Kit for use of the MoClo system in cyanobacteria... Figure 3: Assembly of plasmids using the Cyanogate Kit and subsequent transformation into cyanobacteria...Image from Vasudevan et al., 2018. Find the CyanoGate kit at Addgene. Vasudevan et al., Plant Physiol... -
Antibodies 101: Affinity Reagents
TypeBlog Post...most of the alternative reagents have reduced immunogenicity. Effector functions are eliminated, as is antibody...antibody has been identified but a smaller or less immunogenic version is needed. Single-chain fragment variables... The lack of constant region makes them less immunogenic, but they have lower affinity and longevity compared... -
Adeno Associated Virus (AAV) for Cell and Gene Therapy
TypeBlog Post...have serious adverse effects, and their immunogenic or carcinogenic profiles have limited their usability...associated with any pathogenicity and has a low immunogenic profile. AAV was first discovered as a contaminant... -
What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program
TypeBlog Post...using them grow. So, think beyond Drosophila melanogaster or Saccharomyces cerevisiae (both fine research...species have very different social behavior. One is monogamous and one is promiscuous and the gene that is responsible...this gene with RNAi to make a polygamous species monogamous. Anolis sagrei (Doug Menke) No methods were available... -
Five Popular Model Organisms
TypeBlog Post...fly (Drosophila melanogaster) Another popular model organism is Drosophila melanogaster, or as it is more...Nichols. "Human disease models in Drosophila melanogaster and the role of the fly in therapeutic drug ... -
Plasmids for Stem Cell Research
TypeCollection...reprogramming human cells to pluripotency by activating enogenous genes Human pluripotent reprogramming with CRISPR...Otonkoski Lentivirus Human Expression of human Sox2, Nanog, Oct4, and Lin28 from four separate lentiviral plasmids...polycistronic expression of human Oct4, Klf4, Sox2, c-Myc, Nanog, Lin28, NR5A2, and microRNA 302/367 in three different... gene-specific plasmids at the following links: NANOG , OCT4 , SOX2 , MYC , KLF4 , LIN28 . Differentiation... reprogramming of fibroblasts to expandable, myelinogenic oligodendrocyte progenitor cells. Nat Biotechnol... -
Genetic Code Expansion
TypeCollection...G1 PylRS Methanogenic archaeon Bacterial Ahmed Badran 209739 pAB228i24 G1 PylRS Methanogenic archaeon ...TAG Ryan Mehl 207516 pRSF-G1(7AW)RS G1(7AW)RS Methanogenic archaeon 7-Aza-L-Tryptophan (7AW) Bacterial ...Huber 207620 pRSF-G1(4/5FTrp)RS G1(4/5FTrp)RS Methanogenic archaeon 4-Fluoro-L-Tryptophan (4FTrp), 5-Fluoro-L-Tryptophan...Huber 207621 pRSF-G1(6/7FTrp)RS G1(6/7FTrp)RS Methanogenic archaeon 6-Fluoro-L-Tryptophan (6FTrp), 7-Fluoro-L-Tryptophan... -
Validated gRNA Sequences
TypeCollection...25619936 Sato NANOG H. sapiens TGGCATATTCCTGATTTAAAAGT 64156 activate S. pyogenes 25619936 Sato NANOG H. sapiens...25619936 Sato NANOG H. sapiens TGGGCCTTGGTGAGACTGGTAGA 64154 activate S. pyogenes 25619936 Sato NANOG H. sapiens...61250 cut S. pyogenes 25491644 Ward yellow D. melanogaster GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186... -
Six Spooky Science Stories and Halloween at Addgene
TypeBlog Post...cytochrome P450 genes discovered in Drosophila melanogaster (Gilbert, 2004). Mutations in these genes are...mediate steroid hormone biosynthesis in Drosophila melanogaster." Molecular and cellular endocrinology 215.1...