We narrowed to 10,763 results for: ESP
-
Plasmid#20816DepositorInsertpGSTag Flag p38 alpha (agf) (Mapk14 Mouse)
TagsFlagExpressionBacterialMutationReplace Thr 180 and Tyr 182 with Ala and Phe resp…Available SinceApril 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
HA-IFITM3-F8-TAG-C105A
Plasmid#122478Purposeexpresses human IFITM3-C105A with unnatural amino acid incorporated site specifically in response to the amber codon TAG in mammalian cells when co-transfected with tRNA synthetase/tRNA pair.DepositorInsertIFITM3 (IFITM3 Human)
TagsHAExpressionMammalianMutationChanged Phenylalanine 8 to amber codon, cysteine …Available SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA-IFITM3-V93-TAG
Plasmid#122479Purposeexpresses human IFITM3 with unnatural amino acid incorporated site specifically in response to the amber codon TAG in mammalian cells when co-transfected with tRNA synthetase/tRNA pair.DepositorAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA-IFITM3-F8-TAG-C71A
Plasmid#122476Purposeexpresses human IFITM3-C71A with unnatural amino acid incorporated site specifically in response to the amber codon TAG in mammalian cells when co-transfected with tRNA synthetase/tRNA pair.DepositorInsertIFITM3 (IFITM3 Human)
TagsHAExpressionMammalianMutationChanged Phenylalanine 8 to amber codon, cysteine …Available SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-J9E534
Plasmid#103078PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertJ9E534(Cas9 coding gene from Alicyclobacillus hesperidum URH17-3-68)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.mIRFP670nano3
Plasmid#244093PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceFeb. 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(mem).iGlucoSnFR2.mIRFP670nano3
Plasmid#244098PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsIgG kappa leader and mIRFP670nano3Available SinceFeb. 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLEXm-hCD45d
Plasmid#247052PurposeFor mammalian expression of human CD45 domains 1 and 2 with C-terminal Maltose-Binding Protein fusion for secretion into the mediumDepositorInserthCD45d1d2-MBP
TagsHis6 and Maltose binding protein (MBP)ExpressionMammalianMutationDomains 1 and 2 only, corresponding to residues 2…Promoterchick β-actin promoterAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSFV_Nb139-NLS-VP64 (3'UTR)_RLEloop
Plasmid#240256PurposeAttenuated PROTEUS vector with Nb139-VP64 transgene. Package VLVs with an envelope-expressing vector such as pCMV-VSV-G, or a transgene-responsive VSV-G expression vector.DepositorInsertnanobody Nb139
TagsNLS-VP64ExpressionMammalianMutationVP64 = 4*VP16[aa437-447]PromoterSFV subgenomic promoterAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(cyto).iGlucoSnFR2.mRuby3
Plasmid#244071PurposeCytosolic expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsmRuby3Available SinceJan. 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTKIU-Tyr
Plasmid#247649PurposeExpresses GFP-SUMO-Tyr-mCherry N-degron reporter driven by aTc responsive promoter, and constitutively expresses Ulp1, from KanR integrating mycobacterial plasmidDepositorInsertsGFP-SUMO-Tyr-mCherry N-degron proteolysis dual-fluorescence reporter
Ulp1 SUMO protease
UseMycobacterial integratingTags3xFLAG tag, HA tag, and Myc tagExpressionBacterialPromoterPTet and PTet (co-operonic with GFP-SUMO-Ser-mChe…Available SinceDec. 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTKIU-Ser
Plasmid#247650PurposeExpresses GFP-SUMO-Ser-mCherry N-degron reporter driven by aTc responsive promoter, and constitutively expresses Ulp1, from KanR integrating mycobacterial plasmidDepositorInsertsGFP-SUMO-Ser-mCherry N-degron proteolysis dual-fluorescence reporter
Ulp1 SUMO protease
UseMycobacterial integratingTags3xFLAG tag, HA tag, and Myc tagExpressionBacterialPromoterPTet and PTet (co-operonic with GFP-SUMO-Ser-mChe…Available SinceDec. 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV.CAGFLEX.(mem).iGlucoSnFR2.mRuby3
Plasmid#244082PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(cyto).iGlucoSnFR2.mIRFP670nano3
Plasmid#244100PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2.H348H.HaloTag
Plasmid#244086PurposeCytosolic expression of green glucose sensor (high affinity) with non-responsive HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2.mIRFP670nano3
Plasmid#244087PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAGFLEX.(cyto).iGlucoSnFR2.mIRFP670nano3
Plasmid#244080PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAGFLEX.(ER).iGlucoSnFR2.HaloTag
Plasmid#244083PurposeER targeted expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsIgG kappa leader and mIRFP670nano3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(ER).iGlucoSnFR2.HaloTag
Plasmid#244090PurposeER targeted expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsIgG kappa leader and mIRFP670nano3Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2.HaloTag
Plasmid#244085PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
pLIB-Cyclin T1
Plasmid#231720PurposeProtein expression in insect cellsDepositorInsertCCNT1 (CCNT1 Human)
ExpressionInsectAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-APOBEC1
Plasmid#229536PurposepMV_hyg encoding Cas3(wt)-rAPOBEC1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsrAPOBEC1
Cas3
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-CDA1
Plasmid#229534PurposepMV_hyg encoding Cas3(wt)-CDA1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsCas3
Cytidine deaminase
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest-pol2-Smarcd1-Myc
Plasmid#227716PurposeExpresses mouse Smarcd1 protein with a Myc tag from a Pol2 promoter. Has a Blasticidin resistance gene for stable cell line generation and Ampicilin for plasmid propagation.DepositorAvailable SinceNov. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2117-FKBP-GPA-114-RH-CyOFP1
Plasmid#222884PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, RH linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-RH-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2116-FRB-GPA-114-RH-CyOFP1
Plasmid#222883PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, RH linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-RH-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2379-FKBP-GPA(V84R)-20-11S
Plasmid#222901PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FKBP ectodomain, human Glycophorin A (GPA) (V84R) scaffold, 20 GS linker, split Nanoluciferase fragment 11SDepositorInsertFKBP-GPA(V84R)-20GS-NanoLuc11S
TagsMycExpressionMammalianMutationV84R in GPAPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2380-FKBP-GPA(V84R)-20-114
Plasmid#222900PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FKBP ectodomain, human Glycophorin A (GPA) (V84R) scaffold, 20 GS linker, split Nanoluciferase fragment 114DepositorInsertFKBP-GPA(V84R)-20GS-NanoLuc114
TagsMycExpressionMammalianMutationV84R in GPAPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2378-FRB-GPA(V84R)-20-11S
Plasmid#222899PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FRB ectodomain, human Glycophorin A (GPA) (V84R) scaffold, 20 GS linker, split Nanoluciferase fragment 11S.DepositorInsertFRB-GPA(V84R)-20GS-NanoLuc11S
TagsMycExpressionMammalianMutationV84R in GPAPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2377-FRB-GPA(V84R)-20-114
Plasmid#222898PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FRB ectodomain, human Glycophorin A (GPA) (V84R) scaffold, 20 GS linker, split Nanoluciferase fragment 114.DepositorInsertFRB-GPA(V84R)-20GS-NanoLuc114
TagsMycExpressionMammalianMutationV84R in GPAPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2085-WT-GPA-NLuc-Biosensor-Retrovirus-TD135
Plasmid#222875PurposeRetroviral vector encoding biosensor chains to detect rapamycin (FRB/FKBP domains) and respond with split NanoLuciferase reconstitution (11S/114 fragment). WT Glycophorin A (GPA) scaffold.DepositorInsertFRB-GPA(WT)-NanoLuc114-T2A-FKBP-GPA(WT)-NanoLuc11S
UseRetroviralTagsMycExpressionMammalianPromoterMSCV LTRAvailable SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2132-FKBP-GPA-114-5-CyOFP1
Plasmid#222891PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 5 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-5GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2127-FRB-GPA-114-20-CyOFP1
Plasmid#222886PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 20 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-20GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2129-FRB-GPA-114-5-CyOFP1
Plasmid#222888PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 5 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-5GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2128-FRB-GPA-114-10-CyOFP1
Plasmid#222887PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 10 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-10GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2131-FKBP-GPA-114-10-CyOFP1
Plasmid#222890PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 10 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-10GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2130-FKBP-GPA-114-20-CyOFP1
Plasmid#222889PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 20 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-20GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQE30-VRN1
Plasmid#159531PurposeExpresses Arabidopsis thaliana VERNALIZATION1 in E. coliDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
EC71102
Plasmid#154065PurposeLevel 0 Golden Gate vector; Unmodifed CREDepositorInsertCRE
UseSynthetic Biology; Standard cloning vector used b…MutationAll BsaI, Esp3I and BPiI restriction sites were r…Available SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
KHBD00016
Plasmid#34178DepositorInsertCG8361 (E(spl)m7-HLH Fly)
UseGateway donor vectorAvailable SinceJan. 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
JL054: pPB_NFκB::GFP-GEMINI(A)-P1N4_TRE::HaloTag-GEMINI(A)_UbC::rtTA3-IRES-PuroR
Plasmid#228884PurposePiggyBac plasmid expressing the destabilized GFP-GEMINI(A) under the control of a synthetic NFκB-responsive promotor, and rtTA3 and PuroR under the control of a UbC promoter.DepositorInsertGFP-fused GEMINI(A), HaloTag-fuse GEMINI(A)
ExpressionMammalianPromoterpNFκB; TREAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
ARR3tk-eGFP/SV40-mCherry
Plasmid#132360PurposeTo measure transcriptional activity of Androgen ReceptorDepositorInsertAR responsive elements (AR Human)
UseLentiviralAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
Luciferase
Plasmid#213979PurposeExpresses Doxy Inducible LuciferaseDepositorInsertLuciferase
UseLentiviralTags6xHis affinity tagExpressionBacterial and MammalianPromoterTet-responsive promoter PTight, consisting of sev…Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-Galpha-s ONE-GO
Plasmid#189731PurposeGPCR/G protein BRET biosensorDepositorInsertsUseLentiviralAvailable SinceJan. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRRL-SFFV-rtTA3-IRES-Luc-P2A-mtagBFP
Plasmid#176027Purposeconstruct expresses the reverse tet-responsive transactivator 3 (rtTA3) together with Luciferase (Luc) for bioluminescence in vivo imaging, and mTaqBFP for enriching transgenic cells by flow cytometryDepositorInsertsrtTA3
Luc2
mtagBFP
UseLentiviralAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pEND-351_Cacnes_dCas9_CRISPRi
Plasmid#225617PurposeCutibacterium acnes replicative plasmid with dCas9 for CRISPRi. pBRESP36A-based vector optimized for reduced size and modular assembly, harbouring a medium-copy pBR322 E. coli ori (no ROP)DepositorInsertdCas9
UseCRISPR and Synthetic BiologyTags6xHisExpressionBacterialMutationCodon optimized for Cutibacterium acnesAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only