We narrowed to 899 results for: Gcat
-
Plasmid#232106PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg-ADE2
Plasmid#232104PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg-ADE2
Plasmid#232107PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMTHFD1
Plasmid#217436PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human MTHFD1DepositorInsertsgRNA targeting MTHFD1 (MTHFD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-ZC3HAV1-ts1
Plasmid#174289PurposeZC3HAV1 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAf-CRISPR-ctfR1
Plasmid#207992PurposeCRISPR vector used with pAf-CRISPR-phoA (#207991) to delete both aflatoxin and cyclopiazonic acid gene clusters of Aspergillus flavusDepositorInsertctfR1
UseCRISPRPromoterAspergillus flavus U6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-NS-B
Plasmid#207824PurposeDual expression of Cas9 and non-specific sgRNADepositorInsertnon-specific sgRNA
UseCRISPR and LentiviralTagsFLAGPromoterEF-1a; U6Available SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shPP1C #1
Plasmid#198762Purposeconditional knockdown of PP1CDepositorInsertshPP1C #1 (PPP1CC Human)
ExpressionMammalianAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgFADD guide 2
Plasmid#193590PurposeFADD knockoutDepositorInsertsgFADD guide 2 (FADD Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shStk16-3
Plasmid#180393PurposeProducing AAV that encodes mouse Stk16 shRNA-2 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx3_gRNA1_dTet_mTurquoise2
Plasmid#189804PurposeRetroviral delivery of guide RNA against mouse Runx3DepositorInsertgRunx3_gRNA1 (Runx3 Mouse)
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgCebpa_v2-hu6-sgCebpb_v2
Plasmid#177252PurposeExpresses Cebpa_v2 (mU6), Cebpb_v2(hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v2/sgCebpb_v2
UseLentiviralPromotermU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgCebpa_v2-hu6-sgCebpd_v2
Plasmid#177254PurposeExpresses Cebpa_v2 (mU6), Cebpd_v2(hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v2/sgCebpd_v2
UseLentiviralPromotermU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
hu6-sgCebpa_v2 (opti)
Plasmid#177246PurposeSame as pLL3.3;U6(BstXI)-XhoI-chimeric RNA;PGK-Cre but XhoI stuffer removed, expresses Cebpa gRNADepositorInsertsgCebpa_2nd
UseLentiviralPromoterhU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDF0428 huDisCas7-11-R1045-GGGS-R1122-U6-pro-Gluc
Plasmid#186985PurposeAAV transgene plasmid for Cas7-11-R1045-GGGS-R1122, with U6 promoter-driven expression of Gluc crRNA guideDepositorInsertcas7-11-r1045-gggs-r1122, Gluc crRNA guide
UseAAVMutationr1045-gggs-r1122 deletionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178099PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_I2017T_Dual_pegRNA
Plasmid#178103PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-I2017T pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR-I2017T pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Exon-44_Dual_sgRNA
Plasmid#178105PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick exon-44 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_MTOR_I2017T_Dual_pegRNA
Plasmid#178108PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 T804N-G6 and MTOR-I2017T pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G6 T804N pegRNA + MTOR-I2017T pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only