We narrowed to 19,443 results for: MUT
-
Plasmid#40986DepositorAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only
-
pBABEpuro-ERBB2 C338S
Plasmid#40987DepositorAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBABEpuro-ERBB2 C331S
Plasmid#40989DepositorAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11A G567S
Plasmid#239214PurposeExpresses CDK11A with G567S resistance mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11A with G567S resistance mutation (CDK11A Human)
UseLentiviralExpressionMammalianMutationchanged Glycine 567 to SerineAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BRAF-REG-T241P-Halo
Plasmid#202549PurposeMammalian expression construct encoding the BRAF regulatory (REG) domain (AA 1-435) with a C-terminal HaloTag. The REG domain contains the RASopathy mutation, T241P, within its cysteine-rich domain.DepositorInsertBRAF regulatory (REG) domain (AA 1-435) (BRAF Human)
TagsHaloTagExpressionMammalianMutationThreonine 241 mutated to prolinePromoterCMVAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem(5A)-GFP
Plasmid#162504PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One wildtype Tac stem region is inserted within ST and the other mutated Tac stem region is inserted between ST and GFP.DepositorTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBABEpuro-ERBB2 C299S
Plasmid#40988DepositorAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCSm5En2CER4(#457)
Plasmid#184090Purposecyclofen-inducible chicken EN2 (mut) activation via mammalian cell transfection or mRNA synthesisDepositorInsert5myc-chkEn2(C>S)-ERT2
UseSynthetic BiologyTags5xMycExpressionMammalianMutationchkEn2: C175S; ERT2: G400V, M543A, L544A, deleted…PromotersCMV+SP6Available SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22gcfUbm5En25EE4PCh(#552)
Plasmid#184092Purposecyclofen-inducible chicken EN2 (mut) activation in zebrafish permanent transgenicDepositorInsert5myc-chkEn2(5E)-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)Tags5xMycMutationchkEn2: S150E, S151E, S153E, S155E, S156E; ERT2: …PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only