We narrowed to 14,799 results for: mal.3
-
Plasmid#128627PurposeMammalian Expression Plasmid of anti-Kv4.3 K+ channel (Rat). Derived from hybridoma K75/41.DepositorInsertanti-Kv4.3 K+ Channel (Rat) recombinant mouse monoclonal antibody (Kcnd3 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
Munc18cF119E-pDEST27
Plasmid#85625PurposeGST tagged Munc18c with a F119E mutationDepositorAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEBB XIAP W310A Delta RING
Plasmid#25681DepositorAvailable SinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
SSTR3-DuET
Plasmid#213378PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
JAK3 gRNA (BRDN0001145049)
Plasmid#77190Purpose3rd generation lentiviral gRNA plasmid targeting human JAK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pWZL-neo delta-p85
Plasmid#10888DepositorInsertdelta-p85 (PIK3R1 Bovine)
UseRetroviralExpressionMammalianMutationDeletion of aa 478-513Available SinceDec. 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
ADRB3-DuET
Plasmid#213182PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDendra2-5'UTR(GAPDH)-Dendra2-3'UTR(GAPDH)
Plasmid#182368PurposeDendra2-based translation reporterDepositorInsertglyceraldehyde-3-phosphate dehydrogenase (Gapdh Mouse)
TagsPal-Dendra2ExpressionMammalianPromoterCMV promoterAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_SIK3_CR_T221A
Plasmid#108107PurposeLentiviral expression plasmid of human SIK3 cDNA (CRISPR-resistant silent mutation & TA mutation at LKB1 phosphorylation site) with neomycin resistance geneDepositorInsertSIK3 (SIK3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationchange guanine 501 to cytosine (silent mutation),…PromoterEFS promoterAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only