We narrowed to 17,573 results for: She
-
Plasmid#219886PurposeThe base plasmid of TUNEYALI for TF21DepositorInsertContains gRNA targeting TF21 (YALI1_E20635g) and homologous arm matching TF21
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13215
Plasmid#219890PurposeThe base plasmid of TUNEYALI for TF25DepositorInsertContains gRNA targeting TF25 (YALI1_B18134g) and homologous arm matching TF25
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13221
Plasmid#219896PurposeThe base plasmid of TUNEYALI for TF31DepositorInsertContains gRNA targeting TF31 (YALI1_D18727g) and homologous arm matching TF31
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13235
Plasmid#219908PurposeThe base plasmid of TUNEYALI for TF45DepositorInsertContains gRNA targeting TF45 ( YALI1_B23373g) and homologous arm matching TF45
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13212
Plasmid#219887PurposeThe base plasmid of TUNEYALI for TF22DepositorInsertContains gRNA targeting TF22 (YALI1_C25288g) and homologous arm matching TF22
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13202
Plasmid#219877PurposeThe base plasmid of TUNEYALI forTF12DepositorInsertContains gRNA targeting TF12 (YALI1_C06870g) and homologous arm matching TF12
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13234
Plasmid#219907PurposeThe base plasmid of TUNEYALI for TF44DepositorInsertContains gRNA targeting TF44 (YALI1_B22561g) and homologous arm matching TF44
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13219
Plasmid#219894PurposeThe base plasmid of TUNEYALI for TF29DepositorInsertContains gRNA targeting TF29 (YALI1_C09133g) and homologous arm matching TF29
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13248
Plasmid#219919PurposeThe base plasmid of TUNEYALI for TF58DepositorInsertContains gRNA targeting TF58 (YALI1_F37742g) and homologous arm matching TF58
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pR6K-crRNA-CASTIF
Plasmid#199654PurposeR6K plasmid with a I-F CAST targeting lacZDepositorInsertCAST I-F systems
ExpressionBacterialPromoterJ23119 promoterAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pR6K-GFP-CASTIB
Plasmid#199655PurposeR6K plasmid with a I-B CAST but no CRISPR arrayDepositorInsertCAST I-B systems
ExpressionBacterialPromoterJ23119 promoterAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-tRNAGln-BbsI-sU6-Kan
Plasmid#213016PurposeVector for Cloning of multiple gRNAs driven by distinct promoters (tRNA-Gln and synthetic U6)DepositorInserttRNAGln promoter, sU6 promoter, gRNA scaffolds
PromotertRNAGln promoterAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-ORF3cHA
Plasmid#208653PurposeExpress ORF3c-HA in mammalian cellsDepositorAvailable SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHflu1
Plasmid#203878PurposepSU20 with addition of CEN6-ARSH4-HIS3 cassette for S. cerevisiae and RK2 origin of conjugal transferDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterial and YeastAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
HT152_pAAV_EF1a_fDiO_pAce
Plasmid#208610PurposeExpressing pAce in a Flp-dependent mannerDepositorInsertpAce
UseAAVTagsmNeon GreenExpressionMammalianPromoterEF1aAvailable SinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFPV25.1_dGFPmut3-LVA
Plasmid#187378PurposerpsM promoter driving the expression of destabilized GFPmut3 (containing a LVA C-terminal tail)DepositorInsertdGFPmut3_LVA
TagsLVAExpressionBacterialMutationC-terminal LVA tailAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-p15 Bid-KKAA-GFP
Plasmid#191970PurposeExpression of the active p15 cBid KKAA mutant, chimera with GFP.DepositorInsertp15 - cBid KKAA
ExpressionMammalianMutationKKAA: Lys 157 and Lys 158 into AlaAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB611
Plasmid#185112PurposePom152 central repeats 4 and 5 in pEX-N-His for bacterial expression and purificationDepositorInsertPOM152
Tags6HisExpressionBacterialMutationPom152 repeats 4&5-6HisAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only