We narrowed to 889 results for: Px330
-
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
LC3B sgRNA
Plasmid#207556PurposepX330 expressing Cas9 and a sgRNA targeting the LC3B locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG9A sgRNA
Plasmid#207557PurposepX330 expressing Cas9 and a sgRNA targeting the ATG9A locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
WIPI2 sgRNA
Plasmid#207554PurposepX330 expressing Cas9 and a sgRNA targeting the WIPI2 locusDepositorInsertCGCGCGCCCAGCCATGAACC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX-evoCas9
Plasmid#107550PurposeExpresses the M495V/Y515N/K526E/R661Q (evoCas9) SpCas9 variant in mammalian cellsDepositorInsertHumanized S. pyogenes Cas9
UseCRISPRTags3XFLAGExpressionMammalianMutationM495V/Y515N/K526E/R661QPromoterCBhAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
7a sgRNA for EJ7-GFP and 4-μHOM reporters
Plasmid#113620PurposesgRNA/CAS9 expression plasmid to induce the 5’ double-strand break in both the EJ7-GFP and 4-μHOM reportersDepositorInsert7a sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX851
Plasmid#62883PurposeN-term SpCas9 piece of inducible split-4 (Cas9(N)-FRB-NES split-4).DepositorInsertSpCas9 (aa 2-535)
UseCRISPRTagsFRB and NES PTK2ExpressionMammalianPromoterCBhAvailable SinceMarch 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
7b sgRNA for EJ7-GFP reporter
Plasmid#113624PurposesgRNA/CAS9 expression plasmid to induce the 3’ double-strand break in the EJ7-GFP reporterDepositorInsert7b sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX852
Plasmid#62884PurposeC-term SpCas9 piece of inducible split-4 (Cas9(C)-FKBP split-4).DepositorInsertSpCas9 (aa536-1368)
UseCRISPRTagsFKBP12, NLS SV40, and NLS nucleoplasminExpressionMammalianPromoterCBhAvailable SinceMarch 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC57-GFP-SFPQ-RT
Plasmid#97090PurposeEncodes a HR repair template for knock-in of an EGFP insert that fused to the 5'-end of human SFPQ gene, without disturbing its promoter. Best used with px330-GFP-SFPQ vector.DepositorInsertEGFP-SFPQ-RT (SFPQ Human)
UseCRISPRAvailable SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX853
Plasmid#62885PurposeN-term SpCas9 piece of inducible split-5 (Cas9(N)-FRB-NES split-5).DepositorInsertSpCas9 (aa 2-573)
UseCRISPRTagsFRB and NES PTK2ExpressionMammalianPromoterCBhAvailable SinceMarch 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX854
Plasmid#62886PurposeC-term SpCas9 piece of inducible split-5 (Cas9(C)-FKBP split-5).DepositorInsertSpCas9 (aa573-1368)
UseCRISPRTagsFKBP12, NLS SV40, and NLS nucleoplasminExpressionMammalianPromoterCBhAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA(MS2)_EF1a-MS2-P65-HSF1
Plasmid#92120PurposeExpression plasmid for both MS2-P65-HSF1 activator helper complex and sgRNA with two MS2 loops at tetraloop and stemloop 2 contains BsaI sites for insertion of spacer sequences.DepositorAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mScarlet-LMNB1
Plasmid#207771PurposeDonor template for mScarlet insertion into the N-terminus of the LMNB1 locus for nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a mScarlet Tag (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Solo-mStayGold-CENPA
Plasmid#227283PurposeDonor template for mStayGold insertion into the N-terminus of the CENPA locus. For centromere visualization. To be co-transfected with sgRNA plasmid px330-CENPA (Addgene #227282)DepositorInsertCENPA Homology Arms flanking a mStayGold Tag (CENPA Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mScarlet-TUBA1B
Plasmid#207764PurposeDonor template for mScarlet insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a mScarlet Tag (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
bbCas9pluspAAA
Plasmid#82581PurposeThe plasmid encodes the T7 promoter, Cas9 (from pX330 #42230) and a stretch of poly-A. After linearization with restriction enzyme SapI It is used to produce in vitro transcribed mRNADepositorInsertCas9
ExpressionBacterialPromoterT7Available SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only