We narrowed to 890 results for: Px330
-
Plasmid#232926PurposeDonor plasmid for tagging mouse CTCF with mAID-eGFP at the N-terminus. Used with KL061 - PX330-sgRNA006_CTCF sgRNA.DepositorPublicationInsertmAID-eGFP with mCTCF homology arms
UseMouse TargetingAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
LC3B sgRNA
Plasmid#207556PurposepX330 expressing Cas9 and a sgRNA targeting the LC3B locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available sinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG9A sgRNA
Plasmid#207557PurposepX330 expressing Cas9 and a sgRNA targeting the ATG9A locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
WIPI2 sgRNA
Plasmid#207554PurposepX330 expressing Cas9 and a sgRNA targeting the WIPI2 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCGCGCGCCCAGCCATGAACC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
bbCas9pluspAAA
Plasmid#82581PurposeThe plasmid encodes the T7 promoter, Cas9 (from pX330 #42230) and a stretch of poly-A. After linearization with restriction enzyme SapI It is used to produce in vitro transcribed mRNADepositorInsertCas9
ExpressionBacterialPromoterT7Available sinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUC57-GFP-SFPQ-RT
Plasmid#97090PurposeEncodes a HR repair template for knock-in of an EGFP insert that fused to the 5'-end of human SFPQ gene, without disturbing its promoter. Best used with px330-GFP-SFPQ vector.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEGFP-SFPQ-RT (SFPQ Human)
UseCRISPRAvailable sinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX851
Plasmid#62883PurposeN-term SpCas9 piece of inducible split-4 (Cas9(N)-FRB-NES split-4).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpCas9 (aa 2-535)
UseCRISPRTagsFRB and NES PTK2ExpressionMammalianPromoterCBhAvailable sinceMarch 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX852
Plasmid#62884PurposeC-term SpCas9 piece of inducible split-4 (Cas9(C)-FKBP split-4).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpCas9 (aa536-1368)
UseCRISPRTagsFKBP12, NLS SV40, and NLS nucleoplasminExpressionMammalianPromoterCBhAvailable sinceMarch 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX-evoCas9
Plasmid#107550PurposeExpresses the M495V/Y515N/K526E/R661Q (evoCas9) SpCas9 variant in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHumanized S. pyogenes Cas9
UseCRISPRTags3XFLAGExpressionMammalianMutationM495V/Y515N/K526E/R661QPromoterCBhAvailable sinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
7a sgRNA for EJ7-GFP and 4-μHOM reporters
Plasmid#113620PurposesgRNA/CAS9 expression plasmid to induce the 5’ double-strand break in both the EJ7-GFP and 4-μHOM reportersDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert7a sgRNA
UseCRISPRExpressionMammalianAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
7b sgRNA for EJ7-GFP reporter
Plasmid#113624PurposesgRNA/CAS9 expression plasmid to induce the 3’ double-strand break in the EJ7-GFP reporterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert7b sgRNA
UseCRISPRExpressionMammalianAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
qTAG-N-Solo-mStayGold-CENPA
Plasmid#227283PurposeDonor template for mStayGold insertion into the N-terminus of the CENPA locus. For centromere visualization. To be co-transfected with sgRNA plasmid px330-CENPA (Addgene #227282)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCENPA Homology Arms flanking a mStayGold Tag (CENPA Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-PGK-Puro-moxGFP
Plasmid#227275PurposeAAVS1 targeting donor for the insertion of Puro and a medium strength PGK expressing moxGFP. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAAVS1 Homology Arms flanking a 2A-Puro-PGK-moxGFP cassette (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mScarlet-TUBA1B
Plasmid#207764PurposeDonor template for mScarlet insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTUBA1B Homology Arms flanking a mScarlet Tag (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits