We narrowed to 23,593 results for: promoter
-
Plasmid#115807PurposeSFFV promoter expresses gag-gfp fusion with no ORF after CypA promoterDepositorInsertgag-gfp
UseLentiviralPromoterSFFVAvailable SinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-hBcan
Plasmid#18966DepositorInsertBrevican (BCAN Human)
ExpressionMammalianAvailable SinceDec. 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA-rnSOX9
Plasmid#62972PurposeExpresses HA-tagged rat SOX9DepositorAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
His10-PS-SNAPf (XSB522)
Plasmid#78512PurposeConstruct for expressing His10 - SNAPf in E. ColiDepositorInsertSNAPf
TagsHis10 followed by a prescission protease claevage…ExpressionBacterialAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pACT2-CAS9c
Plasmid#51055PurposeExpress Eukaryotic-codon-optimized Cas9c gene in yeast under ADH1 promoter for genome editing. SV40 NLS is fused to the C terminal. GAL4 region from pACT2 is removed.DepositorInsertCas9c
UseCRISPRTagsSV40 NLSExpressionBacterial and YeastPromoteryeast ADH1 promoterAvailable SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
hOC-GFPtpz
Plasmid#110207PurposeExpresses GFP in mature bone cells.DepositorInserteGFPtopaz
TagsNoneExpressionMammalianPromoterHuman osteocalcin (BGLAP)Available SinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
NK73
Plasmid#176609PurposeTo test bead engulfment of macrophages.DepositorAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E1.1-RFP
Plasmid#22928DepositorInsertE1.1 binding site from Scardigli et al., 2003 with minimal CMV
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Zeo
Plasmid#227268PurposeEmpty AAVS1 targeting donor for the insertion of Zeo and a strong EF1a promoter. A CDS can be cloned adjacent to the promoter via restriction or gibson cloning using the MluI cut site.DepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE2-Bla(HA–RILP)
Plasmid#102425PurposeHA tag fused to the N-terminus of RILP for the expression in mammalian cells.DepositorInsertRab interacting lysosomal protein (RILP Human)
TagsHAExpressionMammalianPromoterTet-responsiveAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xControlgRNA
Plasmid#224568PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nDsRedFL-intron
Plasmid#177804PurposeAn intron is inserted into the DsRed gene with a nuclear transfer signal and a 3xFlag tag. The intron can be digested with EcoRV and any pre-miRNA can be inserted.DepositorInsertintron
ExpressionMammalianAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMADM-beta
Plasmid#36891DepositorInsertsBeta-Geo
thymidine kinase
ExpressionMammalianPromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pZmUbi-5'UTR
Plasmid#154057PurposeLevel 0 Golden Gate vector, containing the ZmUbi promoter and 5' UTR with Level 0.5-compatible overhangs (Wheat construct)DepositorInsertPromoter and 5' UTR Ubiquitin (Zea mays)
UseSynthetic BiologyExpressionBacterialPromoterN/AAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-PGAL1
Plasmid#41605DepositorInsertGAL1 promoter (GAL1 Budding Yeast)
UseYeast genomic targetingTagsA. gossypii translation elongation factor 1a gene…Available SinceDec. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-OCT4
Plasmid#69537PurposeEpisomal plasmid encoding 5 gRNAS targeting human OCT4 promoterDepositorInsert5 concatenated gRNA transcriptional cassettes targeting OCT4
UseCRISPRAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-dCas9/pMXs-IG
Plasmid#51258PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.DepositorInsert3xFLAG-dCas9
UseCRISPR and RetroviralTags3xFLAG tag and NLS (nuclear localization signal)ExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterLTRAvailable SinceAug. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pL0-MtBCP1Pro
Plasmid#159415PurposeMedicago truncatula BCP1 promoter sequence (1108 bp immediately upstream of start codon) in pICH41295 MoClo Golden Gate level 0 acceptor for Pro+5U modules.DepositorInsertMtBCP1 Promoter
UsePuc19-derivedExpressionBacterialAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHes1-GFP (CC#109)
Plasmid#15133DepositorAvailable SinceJune 8, 2007AvailabilityAcademic Institutions and Nonprofits only