We narrowed to 14,453 results for: Cas9
-
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCB-CBEv1
Plasmid#221138PurposeCoxiella burnetii CRISPR-Cas9 cytosine base editing plasmid version 1 without sgRNA construct. Expresses 3xF-HF-BE3.DepositorInsert3xF-rAPOBEC1-Cas9n(HF)-UGI (HF-BE3)
UseCRISPRTags3xFLAGExpressionBacterialPromoterlacIq-PtacAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
1xNLS-pMJ915v2
Plasmid#88915PurposeFor expression of modified SpyCas9 in e.coli.DepositorInsertCas9
UseCRISPRExpressionBacterialAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRU52
Plasmid#167678PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::spCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU51
Plasmid#167677PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::spCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCfB6677
Plasmid#106155PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6632, integration into Yarrowia lipolytica chromosomal location IntE_1, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCfB6684
Plasmid#106154PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6631, integration into Yarrowia lipolytica chromosomal location IntD_1, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB6682
Plasmid#106152PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6627, integration into Yarrowia lipolytica chromosomal location IntC_2, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
7xNLS-pMJ915v2-sfGFP
Plasmid#88922PurposeFor expression of modified SpyCas9 in e.coli.DepositorInsertsCas9
T7
UseCRISPRExpressionBacterialAvailable SinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
AP568-3
Plasmid#70048Purposeco-expression of Cas9 and crRNA 589 target sequenceDepositorInsertsgRNA for dpy‐10
UseCRISPRExpressionWormAvailable SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTX168
Plasmid#89257PurposeExpress STU (Single Transcriptional Unit) Cas9 with CaMV 35s promoter in plantsDepositorTypeEmpty backboneUseCRISPRTagsSV40 NLSExpressionPlantAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLdSaCN
Plasmid#123261PurposeExpresses Staphylococcus aureus Cas9 (SaCas9) and its gRNA in LeishmaniaDepositorInsertgRNA and SaCas9
UseCRISPR; LeishmaniaAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.sfGFP-RepEntry.iPAC
Plasmid#100893PurposeLentiviral CRISPR-Cas9 ReporterDepositorInsertssfGFP
PAC
Available SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
AP568-2
Plasmid#70047Purposeco-expression of Cas9 and crRNA 589 target sequenceDepositorInsertsgRNA for dpy‐10
UseCRISPRExpressionWormAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCfB6679
Plasmid#106158PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6638, integration into Yarrowia lipolytica chromosomal location IntE_4, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB6681
Plasmid#106157PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6637, integration into Yarrowia lipolytica chromosomal location IntE_3, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd SUP
Plasmid#115489PurposeCRISPR-Cas9 SunTag system to target NtDRMcd to the SUPERMAN locus with two guide RNAsDepositorInsertg2_U6_g1_U6_NOS_NLS_GB1_NLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRU205
Plasmid#167685PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUBQ4-2::asCpf1
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU321
Plasmid#167681PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::asCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only