We narrowed to 918 results for: inha
-
Plasmid#160943PurposeGeneration of retrovirus for the overexpression of Nr4a1 mutant (zinc finger 1 deletion)DepositorInsertNr4a1 (Nr4a1 Mouse)
UseRetroviralTagsHA tagExpressionMammalianMutationDeletion of Zinc finger 1 (C270 to C290)PromoterMSCV-LTRAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-K36M TAIL[1-44]-3AID-HA-2A-mCherryBSD
Plasmid#225872PurposeLentiviral expression of AID degron tagged H3.3(K36M) histone tail corresponding to amino acids 1-44 and mCherry fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mCherryExpressionMammalianMutationamino acids 1-44 from H3.3 K36MAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.EF1a.ChR2-YFP.WPRE.hGH
Plasmid#100056PurposeAAV expression of ChR2 fused to YFP driven byEF1a promoter for optogenetic activationDepositorInsertChR2
UseAAVTagsEYFPExpressionMammalianPromoterEF1aAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4_ChR2opt_mKATE
Plasmid#67958Purposeoptical depolarization of mammalian cellsDepositorInsertChannelrhodopsin 2 opt
TagsmKatushkaExpressionMammalianMutationsynthetically produced for mammalian optimized co…PromoterCMV -TetONAvailable SinceSept. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
hSyn1-FLEX-hChR2-tdtomato
Plasmid#41015DepositorInsertChannelrhodopsin-2
UseAdenoviralTagstdtomatoExpressionMammalianMutationcodon-optimized (human)PromotersynapsinAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40
Plasmid#100054PurposeAAV expression of humanized ChR2 with H134R mutation fused to mCherry driven by CAG promoter for optogenetic activationDepositorHas ServiceAAV1, AAV2, AAV5, and AAV9Insertchannelrhodopsin-2
UseAAVTagsmCherryExpressionMammalianMutationH134R mutation in ChR2PromoterCAGAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-double floxed-eNpHR-EYFP-WPRE-pA
Plasmid#20949PurposeCre-activated AAV expression of halorhodopsin 2.0 (eNpHR) fused to EYFP for optogenetic inhibitionDepositorHas ServiceAAV9Inserthalorhodopsin
UseAAVTagsEYFPExpressionMammalianPromoterEF1alphaAvailable SinceMay 13, 2009AvailabilityAcademic Institutions and Nonprofits only