We narrowed to 872 results for: gcat
-
Plasmid#91794PurposePITCh sgRNA, N-terminal BRD4 sgRNA, and Cas9 expressing plasmid for use with the dTAG knock-in system and BRD4DepositorInsertSpCas9
UseCRISPRExpressionMammalianPromoterchicken β-actin promoterAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P POLA1_2
Plasmid#160790PurposeSuppress POLA1DepositorInsertshPOLA1_2
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9nucl-T2A-mCherry - BAKgRNA1- BAKgRNA2
Plasmid#167295PurposePlasmid encoding for 2 gRNAs targeting the human BAK gene and a CMV driven nuclease Cas9 followed by self-cleaving mCherryDepositorInsertBAK (BAK1 Human)
ExpressionMammalianAvailable SinceApril 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV CMV-DIO-(mCherry-U6)-shRNA(anti-Crh)
Plasmid#214732PurposeExpresses shRNA against CRH, marked with mCherry, in infected and cre positive cellsDepositorInsertanti-Crh shRNA / mCherry
UseAAVAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_Lb
Plasmid#155051PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
POLR2A-N CRISPR pX330
Plasmid#124495PurposeA CRISPR plasmid for targeting the N-terminus coding region of human POLR2ADepositorInsertPOLR2A targeting CRISPR
UseCRISPRPromoterU6 promoterAvailable SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UPP1_sgRNA2
Plasmid#201635PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUPP1 (UPP1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7820 pHR (hU6-crPURI-EFS-PuroR-WPRE)
Plasmid#214883PurposeLentiviral vector encoding RfxCas13d targeting PURI guide arrayDepositorInserthU6-crPURI-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-SETDB1 ts1
Plasmid#115859PurposeSETDB1 knockdownDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2.sgNf1.1
Plasmid#91895PurposesgNf1.1 for Nf1 deletionDepositorInsertsgNf1.1
UseLentiviral and Mouse TargetingExpressionMammalianAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shControl
Plasmid#180386PurposeProducing AAV that encodes negative control shRNA with miR-E backboneDepositorInsertshControl
UseAAV and RNAiPromoterCBAAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_SDHA
Plasmid#177980Purposelentiviral vector expressing Cas9 and a sgRNA targeting SDHADepositorInsertsgRNA targeting SDHA (SDHA Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
AllCB shRNA-1
Plasmid#160065PurposeKnock Down all Collybistin isoformsDepositorAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDL691
Plasmid#231166PurposeT-DNA encoding TRV2 with ipt and mobile gRNAs targeting SlUGT75C1 and SlHAIRLESSDepositorInsertipt and mobile gRNAs targeting SlUGT75C1 and SlHAIRLESS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
NEK7 gRNA (BRDN0001162196)
Plasmid#77740Purpose3rd generation lentiviral gRNA plasmid targeting human NEK7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#1
Plasmid#107726PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Pou5f1
Plasmid#174872PurposeCRISPR vector for generating Pou5f1 STREAMING-tag KI cellDepositorInsertsgRNA for mouse Pou5f1 (Pou5f1 Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only