We narrowed to 6,382 results for: Mag
-
Plasmid#207605PurposesgRNA for the insert of the HaloTag at the endogenous loci of XLFDepositorInsertGTTCTTCCATctgcaaaaaa
UseTagsNoneExpressionMammalianMutationPromoterAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
HaloXRCC4 sgRNA
Plasmid#207606PurposesgRNA for the insert of the HaloTag at the endogenous loci of XRCC4.DepositorInsertTACTGGGTTCAGAAACAAGG
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
HaloKu70 sgRNA
Plasmid#207583PurposesgRNA for the insert of the HaloTag at the endogenous loci of Ku70.DepositorInsertGAGCAGTAGCCAACATGTCA
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCF.111
Plasmid#227187PurposepORTMAGE-Ec1 + supplement E. coli SSBDepositorInsertCspRecT, mutL_E32K, E. coli SSB
UseTagsExpressionBacterialMutationmutL E32KPromoterAvailable sinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only