Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

VV247: sdChR(C138S)-TS-GCaMP6f-ER in fck
(Plasmid #58522)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 58522 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FCK(1.3)GW, from Addgene 22217
  • Backbone size w/o insert (bp) 9240
  • Total vector size (bp) 10059
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Use recombinase-free E. coli
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sdChR(C138S)-TS-GCaMP6f-ER
  • Alt name
    Channelrhodopsin from Scherffelia dubia
  • Species
    Scherffelia dubia
  • Insert Size (bp)
    2420
  • Mutation
    changed Cysteine 138 to Serine
  • Promoter a-CamKII
  • Tag / Fusion Protein
    • GCaMP6f (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCTCGTCAATCAAGCTGGTTC
  • 3′ sequencing primer CCACATAGCGTAAAAGGAGCAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We originally received this gene (sdChR) from Nathan Klapoetke in the Boyden Lab at MIT. We made the C138S point mutation in sdChR. Note that C138 in sdChR is homologous to C128 in ChR2; the ChR2(C128S) point mutant was first made by Berndt et al (reference: Bi-stable neural state switches. Berndt et al (Nat Neurosci. 2009 Feb. 12(2):229-34.) The calcium sensor GCaMP6f (see Addgene plasmid 40755) was obtained from Loren Looger and Douglas Kim.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

sdChR was first published in: Klapoetke, N. C., Y. Murata, S.S. Kim, S.R. Pulver, A. Birdsey-Benson, Y.K. Cho, T.K. Morimoto, A.S. Chuong, E.J. Carpenter and Z. Tian. 2014. Independent optical excitation of distinct neural populations. Nat. Meth. 11, 338-346.

GCaMP6f was published in: Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen et al (Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354.)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VV247: sdChR(C138S)-TS-GCaMP6f-ER in fck was a gift from Adam Cohen (Addgene plasmid # 58522 ; http://n2t.net/addgene:58522 ; RRID:Addgene_58522)
  • For your References section:

    Imaging GFP-Based Reporters in Neurons with Multiwavelength Optogenetic Control. Venkatachalam V, Cohen AE. Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020. 10.1016/j.bpj.2014.08.020 PubMed 25296307