We narrowed to 4,994 results for: IRES
-
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hNFATc2/C(1-686, RIT)FLAG-AVITEV
Plasmid#74055Purposeretroviral expression plasmid for human NFATc2/C(1-686, RIT) (without C-terminal region, with RIT mutation abrogating AP1 binding) with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc2, isoform C (NFATC2 AS 1-686 (N terminus deleted), Human)
UseRetroviralTagsAVI-TEV and FLAGExpressionMammalianMutationsilent mutation A1723C in the sequence of NM_1730…Available SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB-TET-MKOS
Plasmid#20959PurposepiggyBac vector with tet inducible cMyc, KLF4, Oct4, Sox2 for creation of induced pluripotent stem cellsDepositorUsepiggybacTagsIRES-bGeoExpressionMammalianAvailable SinceApril 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
LeGO-iG-CSF2RB
Plasmid#125750PurposeLentiviral Expression Vektor with CSF2RB wildtype cDNA and IRES eGFPDepositorAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
PIG-MycT58A
Plasmid#177648PurposeExpression of mouse Myc with T58A point mutationDepositorInsertMyc-T58A (Myc Mouse)
UseRetroviralTagsGFP and IRESExpressionMammalianMutationT58A point mutationAvailable SinceFeb. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-FLuc
Plasmid#170575PurposeExpress firefly luciferase. Used in MLV-based SARS-CoV-2 pseudovirus assay.DepositorInsertLuc
UseLuciferase and RetroviralTagsNAExpressionMammalianPromoterCMVAvailable SinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLED.NPL
Plasmid#193014PurposeNeuron-specific reporter (CBh promoter, Pls3 exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLED.GluA2
Plasmid#193017PurposeGluA2 (Gria2) flip/flop reporter (hSyn promoter, Gria2 flip/flop exons, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLED.ENS
Plasmid#193016PurposeExcitatory neuron-specific reporter (hSyn promoter, Synrg exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_SEPT2-14-GFP11_SEPT2-14-GFP10
Plasmid#180350Purposemammalian co-expression of human SEPT2 fused to GFP10 and of human SEPT2 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_GFP11-14-SEPT7_SEPT9_i1-14-GFP10
Plasmid#180348Purposemammalian co-expression of human SEPT9_i1 fused to GFP10 and of human SEPT7 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_SEPT9_i1-14-GFP11_SEPT9_i1-14-GFP10
Plasmid#180351Purposemammalian co-expression of human SEPT9_i1 fused to GFP10 and of human SEPT9_i1 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Neo-GFP/V5-Foxa1-(P2A)-Flag-Gata5
Plasmid#105509PurposeMSCV-driven retroviral Foxa1 and Gata5 expression (P2A-linked, V5 and Flag-tagged each)DepositorAvailable SinceFeb. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
T7-VEE-CFP-e2a-SOX2AV-p2a-KLF4
Plasmid#193359Purposeself-replicating RNA vector expressing CFP + human SOX2A61V + KLF4 + PuroRDepositorUseVenezuelan equine encephalitis (vee) virus rna re…ExpressionMammalianMutationSOX2A61V is a highly cooperative point mutant of …PromoterT7Available SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLED.CaRPv1
Plasmid#193018PurposeExcitatory/Inhibitory neuron calcium indicator (hSyn promoter, Synrg exon, jRGECO1a/jGCaMP7b)DepositorInsertBichromatic calcium indicator (jGCaMP7b and jRGECO1a)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLED.RAB
Plasmid#193015PurposePhotoreceptor-specific reporter (CBh promoter, Atp1b2 exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7-VEE-CFP-e2a-SOX2-p2a-KLF4
Plasmid#193358PurposeVEE-CFP-SK (self-replicating RNA vector expressing CFP + human SOX2 + KLF4 + PuroR)DepositorUseVenezuelan equine encephalitis (vee) virus rna re…ExpressionMammalianPromoterT7Available SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_GFP11-14-SEPT7_SEPT9_i3-14-GFP10
Plasmid#180349Purposemammalian co-expression of human SEPT9_i3 fused to GFP10 and of human SEPT7 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_SEPT9_i3-14-GFP11_SEPT9_i3-14-GFP10
Plasmid#180352Purposemammalian co-expression of human SEPT9_i3 fused to GFP10 and of human SEPT9_i3 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_GFP10-14-SEPT7 Gmut2_GFP11-14-SEPT7 Gmut2
Plasmid#180353Purposemammalian co-expression of human SEPT7 Gmut2 fused to GFP10 and of human SEPT7 Gmut2 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 H279DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only