We narrowed to 5,622 results for: crispr cas9 grna plasmid
-
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorInsertVRG4 gRNA (VRG4 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorInsertHIS3 gRNA (HIS3 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorInsertHIS3 gRNA (HIS3 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBUN411
Plasmid#50581PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSExpressionMutationmaize codon optimizedPromoterOsU3p and Ubi1pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHSN401
Plasmid#50588PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSExpressionMutationmaize codon optimizedPromoter2×35Sp and AtU6-26pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAS_gpyrG1
Plasmid#90276Purpose(also pMST621-BB3_gpyrG1_cas9) CRISPR/Cas9 plasmid with gRNA for pyrG1, Cas9DepositorInsertgRNA (pyrg1)
UseA. nigerTagsExpressionBacterialMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAS_gpyrG2
Plasmid#90277Purpose(also pMST620-BB3_gpyrG2_cas9) CRISPR/Cas9 plasmid with gRNA for site pyrG2, Cas9DepositorInsertgRNA (pyrg2)
UseA. nigerTagsExpressionBacterialMutationPromoterAvailable sinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDuRCC-K
Plasmid#81193PurposeExpression of Cas9 and two gRNA cassettes in S. cerevisiae; Kan ResistanceDepositorInsertsCas9
empty gRNA cassette
empty gRNA cassette
UseCRISPRTagsNTSExpressionYeastMutationPlease see depositor comments below., Please view…PromoterROX3 and SNP52pAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDuRCC-N
Plasmid#81194PurposeExpression of Cas9 and two gRNA cassettes in S. cerevisiae; Nourseothricin ResistanceDepositorInsertsCas9
empty gRNA cassette
empty gRNA cassette
UseCRISPRTagsNTSExpressionYeastMutationPlease view depositor comments below and WT - cod…PromoterROX3 and SNP52pAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-SF14P
Plasmid#209448Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the SF14P promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterPtipA; sgRNA expression from SF14P promoterAvailable sinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-kasOP*
Plasmid#209447Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the kasOP* promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterPtipA; sgRNA expression from kasOP* promoterAvailable sinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Afp
Plasmid#99696PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Afp, vector allows for strong activation of mouse Afp, can be packaged and delivered as AAVDepositorInsertdCas9 and gRNA targeting Afp (Afp Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSc1-puro
Plasmid#80438PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cell, and also confers resistance to puromycinDepositorInsertssp Cas9 gRNA
eGFP
Puromycin resistance
UseCRISPRTagsExpressionMammalianMutationPromoterCMV, U6, and hPGKAvailable sinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDB4282
Plasmid#98701PurposeA plasmid containing the 3' portion of the ura4 marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-ura4 systemDepositorInsertgRNA PCR template
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDB4283
Plasmid#98702PurposeA plasmid containing the 3' portion of the bsdMX marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-bsdMX systemDepositorInsertgRNA PCR template
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459-CTNNA1(α-catenin CRISPR KO)
Plasmid#229708PurposeKnockout of a-catenin in mammalian cells using CRISPR-Cas9 technologyDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseTagsExpressionMammalianMutationPromoterCMV promoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pROS17
Plasmid#107931PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS10
Plasmid#107924PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only