We narrowed to 5,461 results for: pAAV

#125974

Targeting expression to neuronal and glial cell types in mice, non-human primates, and human retina

Botond Roska

Juttner et al Nat Neurosci. 2019 Jul 8. pii: 10.1038/s

Sept. 16, 2019

Academic Institutions and Nonprofits only

#90016

Donor vector for ObLiGaRe/ZFN mediated targeting to AAVS1 locus

Eric-Paul Bennett

Pinto et al Nucleic Acids Res. 2017 May 4. doi: 10.1

May 10, 2017

Academic Institutions and Nonprofits only

#122501

Cre-dependent TdTomato expression.

Kimberly Ritola

March 22, 2022

Academic Institutions and Nonprofits only

#175440

Cre-on / Flp-off helpers for N2c rabies monosynaptic tracing; TVA, eGFP and N2cG under Synpasin promotoer

Gordon Fishell

Pouchelon et al Cell Rep. 2021 Nov 9;37(6):109993. doi:

Nov. 16, 2021

Academic Institutions and Nonprofits only

#125889

Targeting expression to neuronal and glial cell types in mice, non-human primates, and human retina

Botond Roska

Juttner et al Nat Neurosci. 2019 Jul 8. pii: 10.1038/s

Sept. 30, 2019

Academic Institutions and Nonprofits only

#122092

AAV plasmid for expressing rsCaMPARI in neurons, nucleus localized

Eric Schreiter

Sha et al Elife. 2020 Sep 15;9. pii: 57249. doi: 1

Oct. 9, 2019

Academic Institutions and Nonprofits only

#59332

Expresses splitTVA-P2A-EGFP

Ian Wickersham

Sept. 8, 2014

Academic Institutions and Nonprofits only

#197886

Can be used to generate AAV virus that will express Turbo/GFP in the presence of Cre

Kazuto Kobayashi

Matsushita et al Cell Rep Methods. 2023 Jan 18;3(2):10039

March 15, 2023

Academic Institutions and Nonprofits only

#159910

Mutagenesis of Ntsr1

Larry Zweifel

Nov. 16, 2020

Academic Institutions and Nonprofits only

#107543

AAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFP

Hélène Marie

Pousinha et al Elife. 2017 Jul 6;6. doi: 10.7554/eLife.

May 1, 2018

Academic Institutions and Nonprofits only