We narrowed to 5,622 results for: crispr cas9 grna plasmid
-
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-mcBEST
Plasmid#209416PurposePlasmid for multiplexed cytosine base editing in streptomycetesDepositorInsertsCodon optimized APOBEC1-nCas9-UGI fusion protein
csy4 from Pseudomonas aeruginosa PAO1
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterbase editing cassette: PtipA ; sgRNAs: PkasO* an…Available sinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMZ374
Plasmid#59896PurposeCombination adh1:cas9/rrk1:sgRNA for CRISPR genome editing in fission yeast: Empty sgRNA target (CspCI placeholder) (see comments).DepositorInsertsCas9
rrk1:sgRNA
UseCRISPRTagsExpressionYeastMutationSilent muation of the CspCI sitePromoteradh1 and rrk1Available sinceOct. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJA55
Plasmid#59935PurposegRNA for cleavage near sqt-1(e1350) locus in C elegansDepositorInsertsqt-1(e1350) gRNA2
UseCRISPRTagsExpressionMutationPromoterU6Available sinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPapi
Plasmid#96921Purposeexpression of S aureus SaCas9 (SauCas9) and two pol III promoters for an Sa gRNA and an Sp gRNA. Intended to be used in SpCas9-expressing cell lines for dual Cas9 "Big Papi" screens. aka pXPR207.DepositorTypeEmpty backboneUseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMEL16
Plasmid#107922PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL10
Plasmid#107916PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL13
Plasmid#107919Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL17
Plasmid#107923PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL12
Plasmid#107918Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL15
Plasmid#107921Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL14
Plasmid#107920PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL11
Plasmid#107917PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
BPK1520
Plasmid#65777PurposeHuman expression plasmid for SpCas9 sgRNA (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-Sp-sgRNADepositorInsertSpCas9 gRNA backbone, without spacer sequence
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTJK459
Plasmid#138008PurposeEmpty sgRNA expression vector for expression of sgRNA for Sp Cas9DepositorTypeEmpty backboneUseLentiviralTagsExpressionMutationU-A flip and hairpin extension: cgtttAagagctaTGCT…PromoterAvailable sinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Pi21
Plasmid#126904PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Pi21
Plasmid#126892PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ CUL3
Plasmid#126891PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only