We narrowed to 7,724 results for: Pol
-
Plasmid#211351PurposeConstitutive lentiviral expression of V5-mScarlet-FAM98B[1-330] fusion proteinDepositorInsertV5-mScarlet-FAM98B[1-330] (FAM98B Human)
UseLentiviralTagsV5 and mScarletMutationTruncation of C-terminal glycine-rich IDRAvailable sinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET30a-FKP-ET64
Plasmid#234665PurposeExpression an ELP-tagged FKP enzymeDepositorInsertfucokinase/GDP-fucose pyrophosphorylase
TagsELPExpressionBacterialAvailable sinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-43 ΔCR GFP
Plasmid#237548PurposeExpression of GFP-tag fused to mutant TDP-43 ΔCRDepositorInsertGFP-tagged TDP-43 ΔCR (TARDBP Human)
TagsEGFPExpressionMammalianMutationTDP-43 316-346 a.a. deletionPromoterCMVAvailable sinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCARGO-RMCE-Xist
Plasmid#233268PurposeCARGO plasmid containing ~22kb dox-inducible Xist transgeneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert22kb Xist gene, including introns
ExpressionMammalianAvailable sinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC6
Plasmid#224346PurposeExpresses human KDAC6 (HDAC6) in insect cellsDepositorAvailable sinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFBOH-MHL_WDR54:1-334
Plasmid#210931PurposeInsect expression of full-length human WDR54. N-terminal 6X His tag with TEV cleavage.DepositorInsertWDR54:M1-V334 (WDR54 Human)
TagsMHHHHHHSSGRENLYFQGExpressionInsectMutationwild typePromoterPolyhedrinAvailable sinceMarch 20, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFBOH-MHL_CORO1C:1-474
Plasmid#210920PurposeInsect expression of full-length human CORO1C. N-terminal 6X His tag with TEV cleavage.DepositorInsertCORO1C:M1-A474 (CORO1C Human)
TagsMHHHHHHSSGRENLYFQGExpressionInsectMutationwild typePromoterPolyhedrinAvailable sinceMarch 20, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFBOH-LIC_DDA1:1-102
Plasmid#210902PurposeInsect expression of full-length human DDA1. Untagged.DepositorAvailable sinceMarch 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
mCherry-Vector
Plasmid#214477PurposeVector control for mCherry fusions. Created from the backbone of Addgene #55043 mCherry-Ezrin-N-14 from Michael Davidson.DepositorInsertmCherry
ExpressionMammalianPromoterCMVAvailable sinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-CUP1-NUbo-GFP-His6
Plasmid#212790PurposeCopper-inducible expression of the artificial test substrate NUbo-GFP-His6 in budding yeastDepositorInsertNUbo-GFP-His6
UseIntegrative vectorExpressionYeastPromoterCUP1Available sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LZ3 iFE
Plasmid#190143PurposeExpresses LZ3Cas9-POLB (LZ3 iFE)DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLZ3Cas9-POLB (LZ3_iFE)
UseCRISPRTags3xFLAGExpressionMammalianMutationCodon Optimized for mammalian cellsAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
DsRed +9e
Plasmid#191766PurposeExpression of DsRed fused to a positively charged polypeptide (2 x KSG) . Overall charge on tetramer: +9eDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDsRed
TagsN terminal fusion of positively charged polypetod…ExpressionBacterial and MammalianPromoterCMVAvailable sinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-TUBB2a-mScarlet
Plasmid#191324PurposeExpresses fluorescent labeled beta Tubulin to measure microtubule densityDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTUBB2a-mScarlet (Tubb2a Mouse)
ExpressionMammalianAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX3
Plasmid#183904Purposedonor plasmid for CRISPR Cas9 knockin near the Aedes aegypti m / M locusDepositorInsertGFP
ExpressionInsectPromoterAedes aegypti PolyubiquitinAvailable sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
FAK
Plasmid#186141PurposeFor expresseion of recombinant FAK using baccolovirus in SF9 cellsDepositorAvailable sinceJune 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CHMP1B 1-199
Plasmid#115326PurposeExpresses residues 1-199 of CHMP1B from a His-SUMO bacterial expression vector. Internal ID: WISP 18-24DepositorAvailable sinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEC626
Plasmid#174367PurposeActivation domain for modular CRISPRa. AD-SYNZIP. Expresses alphaNTD from the E coli RNAP with a SYNZIP17 domain fused to the N terminus.DepositorInsertAlpha N-terminal domain from the E. coli RNA polymerase fused to SYNZIP17
UseSynthetic BiologyExpressionBacterialPromoterJ23106Available sinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
ArpC2_pLib
Plasmid#173679PurposeArpC2 subunit of the Human Arp2/3 complex in a library vector for the biGBac system of insect expressionDepositorAvailable sinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shHuR 3UTR
Plasmid#110414PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
6WNX
Plasmid#162270PurposeBacterial ExpressionDepositorAvailable sinceDec. 17, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits