We narrowed to 3,458 results for: cgas
-
Plasmid#126890PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ WRKY28_1
Plasmid#126887PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Dja6_2
Plasmid#126895PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ WRKY28_1
Plasmid#126899PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ PLDbeta1
Plasmid#126902PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Dja6_1
Plasmid#126894PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ ERF922
Plasmid#126893PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-d2eGFP-empty
Plasmid#26164DepositorInsert
ExpressionMammalianMutation…ccgcCTCGAG[sponge sites]GGGCCCgttt… became …ccgc…Available SinceAug. 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Gria1 Donor;3xV5 KO;Dlg4
Plasmid#240294PurposeKI:Gria1 Donor:3xV5 KO:Dlg4DepositorInsertKI gRNA for Gria1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Sptbn4 Donor;3xV5 KO;Nfasc
Plasmid#240296PurposeKI:Sptbn4 Donor:3xV5 KO:NfascDepositorInsertKI gRNA for Sptbn4
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hPKAalpha
Plasmid#185379PurposeFor mammalian expression of guide RNA: caccgTTTGAACGAATCAAGACCCT that targets human PKA subunit alphaDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
HCP4
Plasmid#166106PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the center of Cyr1 and the other targets a non-coding region on chromosome X (location X1)DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hARAF-1
Plasmid#185367PurposeFor mammalian expression of guide RNA: caccgTGGTCTACCGACTCATCAAG that targets human ARAFDepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgRosa26
Plasmid#159914PurposeMutagenesis of Rosa26 with SauCas9DepositorInsertRosa26 gRNA (Gt(ROSA)26Sor Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEXfrt-SaCas9-U6-sgRosa26
Plasmid#159915PurposeMutagenesis of Rosa26DepositorInsertRosa26 (Gt(ROSA)26Sor Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shLuc
Plasmid#110409PurposeshLuc (Target TTACGCTGAGTACTTCGA), silence LUC gene, blasticidin selection.DepositorInsertLuciferase
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only