-
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
SJZ6-HIS5
Plasmid#228259PurposeTemplate plasmid for yeast gene knockout, uses auxotrophic marker his5 (Schizosaccharomyces Pombe) (complements S.c. his3)DepositorInserthis5
UseTagsExpressionYeastMutationPromoterTEF1 S.c.Available sinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3-SpSuc1
Plasmid#162558PurposeExpresses GST-tagged S.pombe Suc1 in E.coliDepositorInsertSchizosaccharomyces pombe Suc1 (suc1 Fission Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCfB8381
Plasmid#126915PurposePlasmid containing integration cassette at XI-3 integration site in Saccharomyces cerevisiae for overexpression of XdCrtI and tHMG1DepositorInsertXdCrtI and tHMG1
UseTagsExpressionYeastMutationPromoterAvailable sinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4M
Plasmid#104508PurposeUsed to evaluate the expression output of Saccharomyces eubayanus GAL2 promoter with yEGFP used as the reporter geneDepositorInsertSeGAL2 promoter-yEGFP
UseTagsExpressionYeastMutationPromoterAvailable sinceApril 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
YN2_1_IL50_HOlocus
Plasmid#194426PurposeExpresses Cas9 and sgRNA cassettes for targeting the HO locus in yeast Saccharomyces cerevisiaeDepositorInsertCas9
UseTagsExpressionYeastMutationNAPromoterAvailable sinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCfB8383
Plasmid#126917PurposePlasmid containing integration cassette at XI-3 integration site in Saccharomyces cerevisiae for overexpression of tHMG1DepositorInserttHMG1
UseTagsExpressionYeastMutationPromoterAvailable sinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4I
Plasmid#104504PurposeUsed to evaluate the expression output of Saccharomyces kudriavzevii GAL1 promoter with yEGFP used as the reporter geneDepositorInsertSkGAL1 promoter-yEGFP
UseTagsExpressionYeastMutationPromoterAvailable sinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4Q
Plasmid#104512PurposeUsed to evaluate the expression output of Saccharomyces kudriavzevii GAL2 promoter with yEGFP used as the reporter geneDepositorInsertSkGAL2 promoter-yEGFP
UseTagsExpressionYeastMutationPromoterAvailable sinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4L
Plasmid#104507PurposeUsed to evaluate the expression output of Saccharomyces mikatae GAL2 promoter with yEGFP used as the reporter geneDepositorInsertSmGAL2 promoter-yEGFP
UseTagsExpressionYeastMutationPromoterAvailable sinceNov. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB8622
Plasmid#126912PurposePlasmid containing gRNA expression cassette targeting ADE2 in Saccharomyces cerevisiaeDepositorInsertADE2 gRNA
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4H
Plasmid#104503PurposeUsed to evaluate the expression output of Saccharomyces arboricola GAL1 promoter with yEGFP used as the reporter geneDepositorInsertSaGAL1 promoter-yEGFP
UseTagsExpressionYeastMutationPromoterAvailable sinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4J
Plasmid#104505PurposeUsed to evaluate the expression output of Saccharomyces mikatae GAL1 promoter with yEGFP used as the reporter geneDepositorInsertSmGAL1 promoter-yEGFP
UseTagsExpressionYeastMutationPromoterAvailable sinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only