We narrowed to 14,065 results for: CAN
-
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgMAPKAP1_2
Plasmid#124911PurposeTargeting human MAPKAP1 (SIN1) gene by CRISPR-Cas9DepositorInsertMAPKAP1 (MAPKAP1 Human)
UseCRISPR and LentiviralAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgMAPKAP1_3
Plasmid#124913PurposeTargeting human MAPKAP1 (SIN1) gene by CRISPR-Cas9DepositorInsertMAPKAP1 (MAPKAP1 Human)
UseCRISPR and LentiviralAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
KB501: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold; CMV promoter
Plasmid#121813PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and CMV promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-302a-3p
Plasmid#103400PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-302a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-302a-3p target (MIR302A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-885-3p
Plasmid#103744PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-885-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-885-3p target (MIR885 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-579-5p
Plasmid#103661PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-579-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-579-5p target (MIR579 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-510-5p
Plasmid#103593PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-510-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-510-5p target (MIR510 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-495-3p
Plasmid#103568PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-495-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-495-3p target (MIR495 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-26a-1-3p
Plasmid#103377PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-26a-1-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-26a-1-3p target (MIR26A1 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only