We narrowed to 9,225 results for: CAG
-
Plasmid#225363PurposepX459 plasmid encoding the sgRNA protospacer sequence “5’-GCATAATGTCACTACAGATC-3’ to target the LIG4 gene.DepositorAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pk335-CARGO-5mer-Fgf5Pro
Plasmid#227480Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRTagsExpressionMutationPromoterAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-Fgf5Pro
Plasmid#227481Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRTagsExpressionMutationPromoterAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-PrPro
Plasmid#227455Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRTagsExpressionMutationPromoterAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-PrPro
Plasmid#227456Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRTagsExpressionMutationPromoterAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_EWSR1/ZNF384 fusion protein LCD (1-149)
Plasmid#235000PurposeBacterial expression of N-terminally 6His tagged EWSR1/ZNF384DepositorInsertUseTags6xHis-TEVExpressionBacterialMutationPromoterT7Available SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY2261 hACTB atgRNA Paired Guide 1
Plasmid#220991PurposehACTB atgRNADepositorAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperior.retro.neo GFP shDNM1L
Plasmid#220356PurposeRetroviral expression vector for an shDNM1LDepositorAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Luciferase shRNA-TRE
Plasmid#225339PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertLuciferase shRNA (LOC116160065 Mouse)
UseAAV and RNAiTagsExpressionMammalianMutationPromoterTRE (tetracycline-responsive element)Available SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.Control-ZEB2_CRISPRd
Plasmid#216172PurposeExpress the gRNA targeting the control site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- Control- ZEB2.locus
UseLentiviralTagsEGFPExpressionMutationPromoterAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
TDP-43 mRuby K84ONBK
Plasmid#216226PurposeTDP-43 with a C-terminal mRuby tag and Lysine 84 in the NLS mutated to a TAG stop codon for amber codon suppression.DepositorInsertTransactive response DNA binding protein of 43 kDa (TARDBP Human)
UseTagsExpressionMammalianMutationLysine 84 mutated to a TAG stop codonPromoterCMV PromoterAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
UCK2_Deletion_gRNA_1
Plasmid#204672PurposeDual gRNA plasmid for UCK2 deletionDepositorAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
EGFP-ST-P2A-pSC-CAAX
Plasmid#207637PurposeA plasmid encoding EGFP fused to SpyTag (ST) and photocaged SpyCatcher (pSC) localized to the cell membrane via CAAX tag.DepositorInsertEGFP-SpyTag-P2A-photocaged SpyCatcher-CAAX
UseTagsExpressionMammalianMutationAmber stop codon at SC's critical lysinePromoterCMVAvailable SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgCTRL-puro
Plasmid#199634PurposesgRNA control guide targeting intergenic regionDepositorInsertN/A
UseLentiviralTagsExpressionMutationPromoterAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-Csy4
Plasmid#161763PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x Csy4-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
UseTagsExpressionPlantMutationPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-tRNA
Plasmid#161762PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
UseTagsExpressionPlantMutationPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mRab12-1
Plasmid#198475Purposelentiviral stable expression of mRab12 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_2x35Sp_HSP18t_ribozyme_AtPDS3_gRNA10
Plasmid#197959PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by 2x35Sp and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRTagsExpressionPlantMutationPromoter2x35S promoter and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only