We narrowed to 5,265 results for: crispr cas9 expression plasmids
-
Plasmid#155085Purposelentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_LacZ_sgRNA_2
Plasmid#155093Purposelentiviral plasmid expressing Cas9 and gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eVRQR-P2A-EGFP (KAC1028)
Plasmid#242663PurposeCMV promoter expression plasmid for human codon optimized SpCas9-eVRQR(S55R)-BPNLS(SV40)-3xFLAG-P2A-EGFPDepositorInsertpCMV-SpCas9-eVRQR(S55R)-BPNLS(SV40)-3xFLAG-P2A-EGFP
UseCRISPRTagsBPNLSExpressionMammalianMutationeVRQR mutations in SpCas9(S55R/D1135V/G1218R/R133…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
PE_CO-Mini-N
Plasmid#190336PurposeExpressing the N-terminal of PE_CO-Mini using Rma intein and Cas9 673-674 split site, ngRNA and pegRNA for PCSK9 +1A insertionDepositorInsertPE_CO-Mini-N, ngRNA and pegRNA for PCSK9 +1A insertion
UseAAVAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_PHF19_sgRNA
Plasmid#246404PurposeCas9/sgRNA expression plasmid targeting PHF19DepositorInsertPHF19 (PHF19 Human)
ExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRhaB-8xHis-ABE8e-eVRQR (LLH551)
Plasmid#242658PurposepRhaB promoter expression plasmid for ABE8e-eVRQR with an N-terminal His8-tagDepositorInsertpRhaB-8xHis-BPNLS-TadA8e-SpCas9(D10A)-eVRQR-BPNLS
UseCRISPRTags8x-HisExpressionBacterialMutationeVRQR mutations in SpCas9(S55R/D1135V/G1218R/R133…PromoterRhaBAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgCTG-CMV-GFP
Plasmid#216734PurposeAAV plasmid containing sgCTG (target sequence: (CUG)6) driven by a U6 promoter and eGFP under the control of the CMV promoter. Used for in vivo experiments.DepositorArticleInsertsgCTG
UseAAV and CRISPRExpressionMammalianPromoterU6 and CMVAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.8m-VRQR-P2A-EGFP (BKS971)
Plasmid#242653PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with nVRQR(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-SpCas9-VRQR-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.8 mutations in TadA, VRQR mutations in SpCas…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.8m-eVRQR-P2A-EGFP (BKS974)
Plasmid#242655PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with neVRQR(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-VRQR(S55R)-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.8 mutations in TadA, eVRQR mutations in SpCa…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABEmax-eVRQR-P2A-EGFP (LLH575)
Plasmid#242654PurposeCMV promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with neVRQR(D10A) and P2A-EGFPDepositorInsertpCMV-ABEmax-VRQR-S55R-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE7.10 mutations in TadA, eVRQR mutations in SpC…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgSLC35B2
Plasmid#83932PurposeLentiviral vector expressing an sgRNA targeting SLC35B2 NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgSLC35B2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgTPST2
Plasmid#83933PurposeLentiviral vector expressing an sgRNA targeting TPST2 NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgTPST2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgCTRL-2
Plasmid#83935PurposeLentiviral vector expressing a control sgRNA. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCTRL-2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgCTRL-3
Plasmid#83936PurposeLentiviral vector expressing a control sgRNA. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCTRL-3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_Lb
Plasmid#155054PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-SNCAe2-WT
Plasmid#85845PurposeDonor plasmid for SNCA exon2 wild type sequence. Also contains TagBFP and EGFPDepositorAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-SNCAe3-A53T
Plasmid#85848PurposeDonor plasmid for SNCA exon3 A53T sequence. Also contains EGFP and tagBFPDepositorInsertSNCA exon 3 homology arms (SNCA Human)
ExpressionBacterial and MammalianAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only