We narrowed to 68,416 results for: TOR;
-
Plasmid#213766PurposeFluorescent reporter for genetic tracing of mesenchymal Glioblastoma cell-state.DepositorInsertCLGT#3-d2EGFP
UseSynthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pS44i8GH-2
Plasmid#207526PurposeConditionally-replicating in Pseudomonas vector, high-copy-number; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→repA, P14b→msfGFP; SmR/SpRDepositorInsertoriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→repA, P14b→msfGFP
UseCRISPR; Pseudomonas vectorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-dMASS_1_WPRE
Plasmid#209765PurposeAAV virus production for neuronal expression of dMASS_1 under hSyn promoterDepositorInsertdMASS_1
UseAAVExpressionMammalianAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMX_mePOU
Plasmid#206396PurposeExpresses mouse ePOU in mammalian cells, for retrovirus generation.DepositorInsertePOU
UseRetroviralExpressionMammalianAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUBQ10:LLFLS2-2
Plasmid#202188PurposeExpress 'Frost Lisbon' Lemon FLS2-2 gene under the UBQ10 promoterDepositorInsertFlagellin sensing 2
TagsHAExpressionPlantPromoterAtUBQ10Available SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUBQ10:WNFLS2-2
Plasmid#202190PurposeExpress 'Washington navel' Orange FLS2-2 gene under the UBQ10 promoterDepositorInsertFlagellin sensing 2
TagsHAExpressionPlantPromoterAtUBQ10Available SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUBQ10:WNFLS2-1
Plasmid#202189PurposeExpress 'Washington navel' Orange FLS2-1 gene under the UBQ10 promoterDepositorInsertFlagellin sensing 2
TagsHAExpressionPlantPromoterAtUBQ10Available SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUBQ10:LLFLS2-1
Plasmid#202187PurposeExpress 'Frost Lisbon' Lemon FLS2-1 gene under the UBQ10 promoterDepositorInsertFlagellin sensing 2
TagsHAExpressionPlantPromoterAtUBQ10Available SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCINeo CD3 delta
Plasmid#201814PurposeMammalian ExpressionDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-TdIF2
Plasmid#196906Purposevisualization of TdIF2/ERBP as a fusion to mCherryDepositorInsertTdIF2
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-TdIF2
Plasmid#199699Purposevisualization of nucleolus in living mammalian cellsDepositorInsertTdIF2
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_(GGS)3_SNIPR
Plasmid#188343PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a (GGS)3, a Notch1-TMD, a Notch1-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_(GGS)3_Notch1-TMD_Notch1-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_(GGS)9_SNIPR
Plasmid#188345PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a (GGS)9, a Notch1-TMD, a Notch1-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_(GGS)9_Notch1-TMD_Notch1-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_(GGS)12_SNIPR
Plasmid#188346PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a (GGS)12, a Notch1-TMD, a Notch1-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_(GGS)12_Notch1-TMD_Notch1-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_(GGS)15_SNIPR
Plasmid#188347PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a (GGS)15, a Notch1-TMD, a Notch1-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_(GGS)15_Notch1-TMD_Notch1-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_(GGS)18_SNIPR
Plasmid#188348PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a (GGS)18, a Notch1-TMD, a Notch1-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_(GGS)18_Notch1-TMD_Notch1-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_3xFLAG-tag tether
Plasmid#188352PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a 3X-FLAG-ECD, a Notch1-TMD, a Notch1-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_3X-FLAG-ECD_Notch1-TMD_Notch1-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_Notch2 del-NRR
Plasmid#188354PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a Notch2-del-NRR-ECD, a Notch2-TMD, a Notch2-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_Notch2-NRRdeletion-ECD_Notch2-TMD_Notch2-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_Notch3 del-NRR
Plasmid#188355PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a Notch3-del-NRR-ECD, a Notch3-TMD, a Notch3-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_Notch3-NRRdeletion-ECD_Notch3-TMD_Notch3-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_IgG4 SNIPR
Plasmid#188359PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a IgG4-ECD, a Notch1-TMD, a Notch1-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_IgG4-ECD_Notch1-TMD_Notch1-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_OX40 SNIPR
Plasmid#188360PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a OX40-ECD, a Notch1-TMD, a Notch1-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_OX40-ECD_Notch1-TMD_Notch1-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_CD8alpha variant 3
Plasmid#188363PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a CD8alpha-variant3-ECD, a Notch1-TMD, a Notch1-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_CD8alpha-variant3-ECD_Notch1-TMD_Notch1-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::HA-RfA
Plasmid#186404PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of N-ter HA tag and a gene of interest under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28-MBP-CI2F
Plasmid#191254PurposeExpresses chymotrypsin inhibitor with an N-terminal MBP fusion proteinDepositorInsertChymotrypsin Inhibitor 2
TagsMaltose Binding ProteinExpressionBacterialAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::HA-RfA
Plasmid#186411PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion N-ter HA tag-gene of interest under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::venus-RfA
Plasmid#186408PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion gene of interest-C-ter Venus under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA-CFP
Plasmid#186412PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion gene of interest-C-ter CFP under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::RfA-ECFP
Plasmid#186402PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter eCFP under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::venus-RfA
Plasmid#186398PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of N-ter Venus and a gene of interest under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::RfA-HA
Plasmid#186405PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter HA tag under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA-venus
Plasmid#186409PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion N-ter Venus-gene of interest under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA-HA
Plasmid#186410PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion gene of interest-C-ter HA tag under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pG.Lantern-INS-SM50-GFP
Plasmid#135594PurposePropogation of Insulator-SM50 Promoter-GFP DNA for microinjection to visualize Insulator-GFP promoter activity in S. purpuratusDepositorInsertINS-SM50 promoter (SM50 )
UseIn vitro transcription (mrna synthesis)TagsGreen Lantern GFPPromoterCMVAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Flag-stm2585
Plasmid#174397PurposeNative S. Typhimurium gene stm2585 (sarA/steE) with N-terminal GFP and Flag tags.DepositorInsertsarA
TagsEGFP and FlagExpressionMammalianAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pWSK129-stm2585_S130A
Plasmid#174403PurposeBacterial expression of sarA with its GSK3-binding SxxxSP motif mutated to SxxxAP.DepositorInsertsarA
ExpressionBacterialMutationsarA with S130A mutationAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pWSK129-stm2585_Y167F
Plasmid#174402PurposeBacterial expression of sarA with its STAT3-binding YxxQ motif mutated to FxxQDepositorInsertsarA
ExpressionBacterialMutationsarA with Y167F mutationPromoterEndogenousAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Flag-gp130dimer-stm2585
Plasmid#174395PurposeConstitutively active gp130 dimer with codon-optimized stm2585 insert (replacing amino acids 140-179)DepositorInsertIL6ST cytosolic domain and sarA chimera
ExpressionMammalianAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Flag-stm2585
Plasmid#174391PurposeS. Typhimurium gene stm2585 (sarA/steE) codon-optimized for mammalian expression with N-terminal Flag tagDepositorInsertstm2585
TagsFlagExpressionMammalianAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1.2-Zeo-hVKORC1
Plasmid#162776PurposeHuman vitamin K oxidoreductase expressionDepositorInsertVKORC1 vitamin K epoxide reductase complex subunit 1 (VKORC1 Human)
ExpressionMammalianPromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only