We narrowed to 7,229 results for: gan
-
Plasmid#179541PurposePunc-25::tomm20::miniSOG-SL2::RFP unc-54 3' UTR C.elegans D-MN and other neurals expression of miniSOG-SL2 RFPDepositorAvailable sinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pJH2842
Plasmid#179540PurposePacr-5::tomm20::miniSOG-SL2::RFP unc-54 3' UTR C.elegans B-MN and other neurals expression of miniSOG-SL2 RFPDepositorAvailable sinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJH2843
Plasmid#179389PurposePunc-4::tomm20::miniSOG-SL2::RFP unc-54 3' UTR C.elegans A-MN and other neurals expression of miniSOG-SL2 RFPDepositorAvailable sinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
M7MTF7
Plasmid#163282PurposeInducible expression of UniProt identifier M7MTF7DepositorInsertM7MTF7
Tags10xHis and T7ExpressionBacterialPromoterT7Available sinceFeb. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHS29
Plasmid#171205Purposebacterial expression for HIS purification of MEG-3 with mutations in the HMG-like motifDepositorPublicationAvailable sinceJune 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHJ4
Plasmid#158785PurposePan-neuronal nuclear-localized GCaMP expression in C. elegansDepositorInsertPrab-3::nls::GCaMP6m
TagsNLSExpressionWormAvailable sinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCZGY2750
Plasmid#135094PurposeSite specific CRISPR/Cas9 editing of C. elegans Chr IVDepositorInsertsgRNA for cxTi10082 (actgttggatgcctgtgtag)
UseCRISPRExpressionWormPromoterU6Available sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
C113S-HA
Plasmid#113062PurposeExpresses worm KVS-1 C113S in mammalian cellsDepositorAvailable sinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
KHT-1
Plasmid#113054PurposeExpresses worm KHT-1 in mammalian cellsDepositorInsertK+ channel for Habituation to Tap subunit 1
TagsHAExpressionMammalianAvailable sinceAug. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP H2B SL2
Plasmid#227718PurposePlasmid contains GFP H2B SL2, with some nlp-51 homology sequence after, Amp ResistantDepositorInsertGFP H2B SL2 (nlp-51 Nematode)
UseCloning vectorAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4562
Plasmid#200780PurposePflp-18 LoxP EBFP LoxP GtACR2 mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of GtACR2 RFPDepositorInsertGtAR2
TagsmCherryExpressionWormPromoterPflp-18Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4609
Plasmid#200781PurposePpdf-1 LoxP EBFP LoxP GtACR2 mCherry unc-54 3' UTR C.elegans AVB and other neurons expression of GtACR2 RFPDepositorInsertGtACR2
TagsmCherryExpressionWormPromoterPpdf-1Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4293
Plasmid#200161PurposePtwk-40s GCaMP6s::mNeptune unc-54 3' UTR C.elegans AVA,AVB and other neurons expression of GCaMP6 mNeptuneDepositorInsertGCaMP6
TagsmNeptuneExpressionWormPromoterPtwk-40Available sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH4506
Plasmid#200255PurposePnpr-4 TeTx mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of TeTx RFPDepositorInsertTeTx
TagsmCherryExpressionWormPromoterPnpr-4Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4508
Plasmid#200256PurposePflp-18 LoxP EBFP LoxP TeTx mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of TeTx RFPDepositorInsertTeTx
TagsmCherryExpressionWormPromoterPflp-18Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNMSB91
Plasmid#199319PurposeCombine with Gal4 to direct ACR1 expressionDepositorInsert15xUAS::delta pes-10::::ACR1::let-858 3'UTR
ExpressionWormPromoter15xUAS::delta pes-10Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmCardinal-T2A-HO1
Plasmid#197249PurposeExpresses the protein of wmCardinal-T2A-HO1 in neurons of C. elegansDepositorInsertwmCardinal-T2A-HO1
ExpressionWormAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmiRFP720-T2A-HO1
Plasmid#197248PurposeExpresses the protein of wmiRFP720-T2A-HO1 in neurons of C. elegansDepositorInsertwmiRFP720-T2A-HO1
ExpressionWormAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wiRFP713-T2A-HO1
Plasmid#197247PurposeExpresses the protein of wiRFP713-T2A-HO1 in neurons of C. elegansDepositorInsertwiRFP713-T2A-HO1
ExpressionWormAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmRhubarb713-T2A-HO1
Plasmid#197245PurposeExpresses the protein of wmRhubarb713-T2A-HO1 in neurons of C eleganDepositorInsertwmRhubarb713-T2A-HO1
ExpressionWormAvailable sinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only