We narrowed to 165,347 results for: addgene
-
-
-
-
-
-
-
-
-
-
-
-
TAL3184
Plasmid#41358DepositorInsertZebrafishCommunity-stac-Left (LOC100005402 Zebrafish)
Uset7Tags3X Flag and WT FOKIExpressionMammalianPromoterCMVAvailable SinceDec. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
TAL3185
Plasmid#41359DepositorInsertZebrafishCommunity-stac-Right (LOC100005402 Zebrafish)
Uset7Tags3X Flag and WT FOKIExpressionMammalianPromoterCMVAvailable SinceDec. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pIVT-ABE-DEN2
Plasmid#238020Purposefor DNA-free adenine base editing in rice and wheat or other plantsDepositorInsertTadA8e-nSpCas9(D10A)
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-ABE-TMV
Plasmid#238021Purposefor DNA-free adenine base editing in rice and wheat or other plantsDepositorInsertTadA8e-nSpCas9(D10A)
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-A3A-DEN2
Plasmid#238019Purposefor DNA-free cytosine base editing in rice and wheat or other plantsDepositorInsertA3A-nSpCas9(D10A)-UGI
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-Torso
Plasmid#244933PurposeCRISPR gRNA targeting the C-terminal end of Torso for cleavage.DepositorInsertgRNA targeting Torso C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-Btl
Plasmid#244934PurposeCRISPR gRNA targeting the C-terminal end of Breathless for cleavage.DepositorInsertgRNA targeting Btl C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-EGFR
Plasmid#244932PurposeCRISPR gRNA targeting the C-terminal end of EGFR for cleavage.DepositorInsertgRNA targeting EGFR C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only
