We narrowed to 25,004 results for: CHI
-
Plasmid#216172PurposeExpress the gRNA targeting the control site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- Control- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LRG-sgRNA.FOXA-ZEB2_CRISPRd_v2
Plasmid#216173PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-tac-EcTyrRS-VSMA*-lpp-tRNA_CUA^EcTyr
Plasmid#218766Purposeencodes EcTyrRS-VSMA* and EcTyr-tRNA-TAGDepositorInsertEcTyrRS-VSMA*
ExpressionBacterialMutationY37V, D167G, D182S, F183M, L186A, D265RPromotertacIAvailable SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTY186 EGFP-T2A-ALFA-ORF6 SARS-CoV-2
Plasmid#204976PurposeCo-express EGFP and SARS-CoV-2 ORF6 N-terminally labeled with ALFA tagDepositorAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnTS-E1015A
Plasmid#213415PurposeVinculin tension sensor (VcnTS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1015A).DepositorInsertVcnTS-E1015A (VCL Synthetic, Chicken)
ExpressionMammalianMutationMutated vinculin glutamic acid 1015 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnTS-E1021A
Plasmid#213416PurposeVinculin tension sensor (VcnTS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1021A).DepositorInsertVcnTS-E1021A (VCL Synthetic, Chicken)
ExpressionMammalianMutationMutated vinculin glutamic acid 1021 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnCS-E1015A
Plasmid#213412PurposeVinculin conformation sensor (VcnCS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1015A).DepositorInsertVcnCS-E1015A (VCL Synthetic, Chicken)
ExpressionMammalianMutationMutated vinculin glutamic acid 1015 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnCS-E1021A
Plasmid#213413PurposeVinculin conformation sensor (VcnCS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1021A).DepositorInsertVcnCS-E1021A (VCL Synthetic, Chicken)
ExpressionMammalianMutationMutated vinculin glutamic acid 1021 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLINE1ΔORF2-scFvFc
Plasmid#206021PurposeThe ORF2 sequence was removed from pLINE1-scFvFcDepositorInsertmouse LINE1 vector harboring an scFv-Fc expression unit, lacking the ORF2 sequence
ExpressionMammalianAvailable SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
p8319 pDONR ATG-YAP1 WT-Stop
Plasmid#184524PurposeSubcloning YAP1 WTDepositorInsertYAP1 WT (YAP1 Human)
UseUnspecifiedAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSN526
Plasmid#184827PurposeExpresses human KIF5A(∆exon27) in insect cellsDepositorInsertKIF5A (∆exon27) (KIF5A Human)
TagsmScarlet-2xStrepIIExpressionInsectMutation∆exon27 form of human KIF5APromoterpolyhedrinAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2Aneo-mRFP-FKBP-mSos1-linkercat
Plasmid#173858PurposeEncoding a part of the rapamycin-induced Ras activation system.DepositorInsertmRFP-FKBP-mSos1-linkercat
ExpressionMammalianAvailable SinceJan. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-UbC-loxP-canisNrg1
Plasmid#173849PurposeEncoding dog Nrg1 before Cre-mediated recombination.DepositorInsertA cDNA of canis Nrg1
ExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-neo-dTgfa
Plasmid#173842PurposeA knockout vector for the dog Tgfa.DepositorInsertA gRNA targeting the dog Tgfa gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-UbC-canisEgf
Plasmid#173845PurposeEncoding dog Egf.DepositorInsertA cDNA of canis EGF.
ExpressionMammalianMutationR1127Q- please see dep. commentsAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Flag-stm2585-gp130
Plasmid#174393PurposeChimera of codon-optimized stm2585 (sarA/steE) and human gp130 sequence.DepositorInsertsarA-IL6ST chimera
TagsFlagExpressionMammalianMutation140-177 of sarA replaced with homologous IL6ST se…Available SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 CARD8 FIIND L370G
Plasmid#169970PurposepDONR221 for Gateway shuttling. Contains the CARD8 FIIND (L162M-P434, no stop codon) with an interface III mutation (F370G)DepositorAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 CARD8 FIIND L368G
Plasmid#169969PurposepDONR221 for Gateway shuttling. Contains the CARD8 FIIND (L162M-P434, no stop codon) with an interface III mutation (L368G)DepositorAvailable SinceJuly 28, 2021AvailabilityAcademic Institutions and Nonprofits only