We narrowed to 6,116 results for: KIT
-
Plasmid#218014PurposesfGFP fluorescent proteinDepositorInsertsfGFP
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-869
Plasmid#218021PurposeER retention signal (DGDL) for protein targeting to ERDepositorInsertER retention signal (DGDL)
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-843
Plasmid#217997PurposesmtHSP60 for protein targeting to mitochondrial matrixDepositorInsertsmtHSP60
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD043
Plasmid#212913PurposeEncodes the S. cerevisiae 111 amino acid SCW4 Translational Fusion Partner Sequence as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertSCW4 (SCW4 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD084
Plasmid#212921PurposeEncodes the HA-tagged S. cerevisiae Tip1p yeast surface display anchor protein as a Type 4a part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertTIP1 (TIP1 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD041
Plasmid#212911PurposeEncodes the S. cerevisiae YAR066W Translational Fusion Partner Sequence as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertYAR066W (YAR066W Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD044
Plasmid#212914PurposeEncodes the S. cerevisiae 142 amino acid SCW4 Translational Fusion Partner Sequence as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertSCW4 (SCW4 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD009
Plasmid#212906PurposeEncodes S. cerevisiae SRL1 pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertSRL1 (SRL1 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
mc2 hygro hPGK
Plasmid#206228PurposeFor expressing cloned exons as circular RNA. Alternatively, for expressing cDNA (if the EcoRI-XhoI restriction fragment is also removed).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable SinceAug. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
mc2 puro hPGK
Plasmid#206227PurposeFor expressing cloned exons as circular RNA. Alternatively, for expressing cDNA (if the EcoRI-XhoI restriction fragment is also removed).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable SinceAug. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
mc2 hygro EF1a
Plasmid#206222PurposeFor expressing cloned exons as circular RNA. Alternatively, for expressing cDNA (if the EcoRI-XhoI restriction fragment is also removed).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable SinceAug. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA_0_T2A-Gal4vp16_synCoTC_4xnrUAS-mTagBFP2-T2A-sGFP1-10
Plasmid#199487PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorInsertGal4vp16/4xnrUAS-mTagBFP2-T2A-sGFP1-10
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA_1_T2A-Gal4vp16_synCoTC_4xnrUAS-mTagBFP2-T2A-sGFP1-10
Plasmid#199488PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorInsertGal4vp16/4xnrUAS-mTagBFP2-T2A-sGFP1-10
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA_2_T2A-Gal4vp16_synCoTC_4xnrUAS-mTagBFP2-T2A-sGFP1-10
Plasmid#199489PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorInsertGal4vp16/4xnrUAS-mTagBFP2-T2A-sGFP1-10
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA_0_T2A-Gal4vp16_synCoTC_4xnrUAS-mTagBFP2-T2A-sGFP11x7
Plasmid#199490PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorInsertGal4vp16/4xnrUAS-mTagBFP2-T2A-sGFP11x7
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA_1_T2A-Gal4vp16_synCoTC_4xnrUAS-mTagBFP2-T2A-sGFP11x7
Plasmid#199491PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorInsertGal4vp16/4xnrUAS-mTagBFP2-T2A-sGFP11x7
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA_2_T2A-Gal4vp16_synCoTC_4xnrUAS-mTagBFP2-T2A-sGFP11x7
Plasmid#199492PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorInsertGal4vp16/4xnrUAS-mTagBFP2-T2A-sGFP11x7
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEM.F03R
Plasmid#198664PurposeEasy-MISE toolkit pEM-plasmid containing mCherry coding sequence with HI protruding endsDepositorInsertmCherry
UseSynthetic BiologyExpressionYeastAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only