We narrowed to 170,825 results for: addgene
-
Plasmid#236733PurposeDual sgRNA targeting CTRL expressing dAPEX-BFP targeting to ERDepositorInsertNegative CTRL
UseCRISPR and LentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiX_((203-bp-DIAL-YB_TATA)-mGL-BGH)rev_DIV_pKG2948
Plasmid#246343Purpose203-bp DIAL Reporter Lentivirus (with divergent iRFP670) expressing mGreenLantern in the presence of ZFa and editable by Cre recombinaseDepositorInsertmGreenLantern
UseLentiviral and Synthetic BiologyAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiX_((380-bp-DIAL)-mCh-HRasG12V-BGH)rev_DIV_pKG3848
Plasmid#246344Purpose380-bp DIAL (YB_TATA) Reporter Lentivirus (with divergent SNAP) expressing mCherry-HRasG12V in the presence of ZFa and editable by Cre recombinaseDepositorInsertmGreenLantern
UseLentiviral and Synthetic BiologyAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
p-att-ef1a-MS2-RecT-dCas9-BSD
Plasmid#226108PurposeUsing ef-1a promoter, expresses dCas9 and RecT protein that intended to be tethered via MS2 gRNA hairpin to dCas9, and Blasticidin selectionDepositorInsertBSD
UseCRISPRExpressionMammalianAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT PCSK5(sgRR,M452I)-V5
Plasmid#232450PurposeGateway entry vector for an inducible sg09 resistant PCSK5_M452I mutantDepositorAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT PCSK5(sgRR,T288P)-V5
Plasmid#232451PurposeGateway entry vector for an inducible sg09 resistant PCSK5_T288P mutantDepositorAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLIK PCSK5(sgRR)-V5 hygro
Plasmid#232452PurposeLentiviral expression vector for an inducible sg09 resistant PCSK5DepositorAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLIK PCSK5(sgRR,M452I)-V5 hygro
Plasmid#232453PurposeLentiviral expression vector for an inducible sg09 resistant PCSK5_M452I mutantDepositorAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLIK PCSK5(sgRR,T288P)-V5 hygro
Plasmid#232454PurposeLentiviral expression vector for an inducible sg09 resistant PCSK5_T288P mutantDepositorAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-ABE-DEN2
Plasmid#238020Purposefor DNA-free adenine base editing in rice and wheat or other plantsDepositorInsertTadA8e-nSpCas9(D10A)
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-ABE-TMV
Plasmid#238021Purposefor DNA-free adenine base editing in rice and wheat or other plantsDepositorInsertTadA8e-nSpCas9(D10A)
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-A3A-DEN2
Plasmid#238019Purposefor DNA-free cytosine base editing in rice and wheat or other plantsDepositorInsertA3A-nSpCas9(D10A)-UGI
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-Torso
Plasmid#244933PurposeCRISPR gRNA targeting the C-terminal end of Torso for cleavage.DepositorInsertgRNA targeting Torso C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-Btl
Plasmid#244934PurposeCRISPR gRNA targeting the C-terminal end of Breathless for cleavage.DepositorInsertgRNA targeting Btl C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-EGFR
Plasmid#244932PurposeCRISPR gRNA targeting the C-terminal end of EGFR for cleavage.DepositorInsertgRNA targeting EGFR C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
WT-Cas9
Plasmid#239382PurposeFor circular RNA-mediated inverse prime editor using WTCas9 in HEK294T cellsDepositorInsertCas9
UseCRISPRTagsBPNLS and SV40 NLSExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
iPE-WT-Cas9
Plasmid#239379PurposeFor inverse prime editor using WTCas9 in HEK294T cellsDepositorInsertCas9, M-MLV RT
UseCRISPRTagsBPNLSExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMC-ME_BFP-P2A-NTRv2-pA
Plasmid#200538Purposemini circle middle entry plasmid for BFP-P2A-NTR version 2-pA with flanking BsaI cut sitesDepositorInsertBFP, NTRv2
UseMini-goldenAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMC-ME_2a-EGFP-pA ORF-3 without ATG
Plasmid#200519Purposemini circle middle entry plasmid for 2a-eGFP-pA ORF3 (without ATG) with flanking BsaI cut sitesDepositorInserteGFP
UseMini-goldenAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only