We narrowed to 6,501 results for: nls
-
Plasmid#29235PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPle12 (AVP Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable sinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP779_αGCN4-VP64-CO
Plasmid#211772PurposeSunTag counterpart binding domain, αGCN4, fused to transcriptional activator VP64, with GFP selectionDepositorInsertaGCN4-VP64
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect VP64 e…PromoterpEF1a and pSV40Available sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP786_SpyCatcher-EZH2-FL-CO
Plasmid#211779PurposeSpyTag counterpart binding domain, SpyCatcher, fused to polycomb repressive complex subunit EZH2, with GFP selectionDepositorInsertaGCN4-KRAB
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect KRAB e…PromoterpEF1a and pSV40Available sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP787_SnoopCatcher-EZH2-FL-CO
Plasmid#211780PurposeSnoopTag counterpart binding domain, SnoopCatcher, fused to polycomb repressive complex subunit EZH2, with GFP selectionDepositorInsertaGCN4-DNMT3A
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect DNMT3A…PromoterpEF1a and pSV40Available sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
miniTol2 x EF1a_EKAREN4 + PGK-blast
Plasmid#167825PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEKAREN4
Tagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable sinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
B-eSpCas9
Plasmid#126761PurposeExpression plasmid for human codon-optimized increased fidelity Blackjack-eSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than eSpCas9.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertB-eSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationK848A; K1003A; R1060A; amino acids 1005-1013 repl…PromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Gli3ZF in AINGpCAGGS
Plasmid#121972PurposeGli3 zinc fingersDepositorInsertGli3ZF (GLI3 Human)
UseChick electroporationTags5xmycExpressionMammalianMutationN terminus and C terminus deletion only nt 1411-1…Available sinceApril 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEMS1097
Plasmid#29028PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPle201 (SLC6A5 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-Cre-NLSAvailable sinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
U6_ ATM_G101_sgRNA_CAG_St1Cas9_CNRZ1066_v2
Plasmid#214814PurposeA single vector containing a CAG-driven Cas9 variant from S. thermophilus recognizing a consensus NNACAA PAM (St1Cas9 CNRZ1066 v2) and its U6-driven sgRNA targeting human ATMDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSt1Cas9 CNRZ1066 v2 targeting ATM (ATM Human)
UseCRISPRExpressionMammalianPromoterCAGAvailable sinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
AV13_pCAG.Cas9.gRNA.NT
Plasmid#199260PurposeExpression construct encoding SpCas9 nuclease and a control non-targeting guide RNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsSpCas9 nuclease
Non-targeting (NT) control gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCAG promoter and RNA polymerase III promoter for …Available sinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
miniTol2 x EF1a_EKAREN4(TA) + PGK-blast
Plasmid#167827PurposeControl sensor for EKAREN4DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEKAREN4(TA)
Tagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable sinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
B-evoSpCas9
Plasmid#126765PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-evoSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than evoSpCas9.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertB-evoSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationM495V; Y515N; K526E; R661Q; amino acids 1005-1013…PromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ239-RVR
Plasmid#108863PurposeFnCpf1 Gateway entry plasmid with N623R, K629R and N633R mutationsDepositorInsertFnCpf1-RVR (FnCpf1 with N623R, K629R and N633R mutations)
UseCRISPR; Gateway compatible cpf1 entry cloneTagsNLSExpressionPlantMutationN623R, K629R and N633R, Cpf1 is rice codon optimi…Available sinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE4567
Plasmid#107557PurposeExpresses human codon optimized inactive MbCpf1(dead2) in mammalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthMbCpf1(dead2)
Tags3xHA and NLSExpressionMammalianMutationE1080APromoterCMVAvailable sinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
nLbCas12a
Plasmid#213745PurposeFor circular RNA-mediated prime editor using nLbCas12a-D156R-R1138A in HEK293T cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertnLbCas12a
UseCRISPRTagsBPNLSExpressionMammalianMutationD156R, R1138APromoterCMVAvailable sinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDN41
Plasmid#61344PurposemCherry fused to LINuS, a light-inducible nuclear localization signal (biNLS9/PKIt NES)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmCherry
TagsGS linker-AsLov2-biNLS9 and PKIt NESExpressionMammalianPromoterCMVAvailable sinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT (PGK) 5xGRE-NanoLuc
Plasmid#207170PurposeGAl4 response element driven NanoLuc Lentiviral reporterDepositorInsertsNanoLuciferase
d2eGFP
5x GRE
UseLentiviral, Luciferase, and Synthetic BiologyTags3x SV40 NLS and PESTPromoterGal4 response element minP and PGKAvailable sinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP780_SpyCatcher-KRAB-CO
Plasmid#211773PurposeSpyTag counterpart binding domain, SpyCatcher, fused to transcriptional repressor KRAB, with GFP selectionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpyCatcher-KRAB
Tags3xFLAGExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect KRAB e…PromoterpEF1a and pSV40Available sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP784_SnoopCatcher-DNMT3A-CO
Plasmid#211777PurposeSnoopTag counterpart binding domain, SnoopCatcher, fused to DNA methyltransferase DNMT3A, with GFP selectionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpy-EZH2
Tags3xFLAGExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect EZH2 e…PromoterpEF1a and pSV40Available sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only