We narrowed to 607 results for: Anti-CRISPR
-
Plasmid#89648PurposeExpresses an Rbm10-targeting gRNA and Cre-recombinaseDepositorAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPL13A_PQR_mScarlet_NOL_LoxP_PQR_zeo_PQR_MCS_RPL13A-3'UTR
Plasmid#165043PurposeRepair template for CAS9 complex genome editingDepositorInsertRPL13A (RPL13A Human)
ExpressionBacterialAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pX330_EZH2gRNA15
Plasmid#199587PurposeContains guide RNA to 5' end of mouse EZH2 geneDepositorAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA16
Plasmid#199588PurposeContains guide RNA to 3' end of mouse EZH2 geneDepositorAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA17
Plasmid#199589PurposeContains guide RNA to 3' end of mouse EZH2 geneDepositorAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVss-U6-sgHTT51-7sk-Cas9
Plasmid#190901PurposeAAV-KamiCas9 vector expressing sgGFP and mouse HTT sgRNADepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1
Plasmid#190902PurposeAAV vector expressing thew GFP reporter gene and human sgHTTDepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9
Plasmid#190903PurposeAAV-KamiCas9 vector expressing expressing thew GFP reporter gene and sgHTT and sgCas9DepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRepair-mTq2-CTNNB1
Plasmid#153433PurposeHomology Directed Repair construct for N-terminal tagging of hsCTNNB1 with mTurquoise2DepositorInsertCTNNB1 homology arms and mTurquoise2 coding sequence (CTNNB1 Human)
UseCRISPR; Hdr donor templateTagsmTurquoise2Available SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNTI751 pPGK1-GCN4(UTR)-ZEM(TF)
Plasmid#164916PurposeExpresses the ZEM transcription factor under the translational control of the yeast GCN4 5'UTRDepositorInsertGCN4(UTR)-ZEM(TF)
UseSynthetic BiologyExpressionYeastPromoterPGK1 (yeast)Available SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLL5 sgRNA(MS2)-MS2-hA3a D131A
Plasmid#112131Purposeempty sgRNA cloning vector with MS2-humanA3a D131ADepositorInserthuman Apobec3a D131A mutant (APOBEC3A Human)
UseCRISPRExpressionMammalianMutationD131A mutant in hA3aPromoterhU6,CBhAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNeo2/Cre
Plasmid#89652PurposeExpresses a Neomycin-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Neomycin
UseCre/Lox and LentiviralExpressionMammalianAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC0063 PauCas13 (B07) His6-TwinStrep-SUMO-BsaI
Plasmid#115214PurposeExpresses PauCas13b from a SUMO-tagged bacterial expression constructDepositorInsertPauCas13
TagsSUMOExpressionBacterialAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasWT/sgKras/Cre
Plasmid#99848PurposeExpresses Cre-recombinase, a barcoded HDR template that serves as a control for HDR into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12R/sgKras/Cre
Plasmid#99852PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSetd2#1/Cre
Plasmid#89649PurposeExpresses a Setd2-targeting gRNA and Cre-recombinaseDepositorAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Plas-gRNA-Z3EV
Plasmid#157659PurposeGFP gene and gRNA under Z3EV expression control (estradiol sensor), with Z3EV transcription factor to insert in the genome.DepositorInsertGFP-gRNA NatMX Z3EV
UseInsert storage (replicative in e. coli)Available SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only