We narrowed to 17,132 results for: REV
-
Plasmid#197845PurposeDonor vector to restore L1 destination via Esp3I (reverse orientation)DepositorInsertNone
UseUnspecifiedAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD/HisB (TIREVOL)-PAmCherry1
Plasmid#189718Purposetitratable expression of PAmCherry1 in bacteriaDepositorInsertPAmCherry1
TagsHis-T7-EKExpressionBacterialPromoterpBADAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBAD/HisB (TIREVOL)-mNG
Plasmid#189722Purposetitratable expression of mNeonGreen in bacteriaDepositorInsertmNeonGreen
TagsHis-T7-EKExpressionBacterialPromoterpBADAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-Brevican [N294A/10R]
Plasmid#177528PurposeMammalian Expression Plasmid of anti-Brevican (Rat). Derived from hybridoma N294A/10R.DepositorInsertanti-Brevican (Rattus norvegicus) recombinant mouse monoclonal antibody (Bcan Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-Reverse-Complement
Plasmid#136016PurposeThe Reverse Complement of EIF3B 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-JeT-pmRevErbA-mScaI3-NLS-Pest
Plasmid#240107PurposeA lentiviral (red) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by synthtic JeT promoter.DepositorInsertmurine Nr1d1 promoter+mScarlet-I3-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded JeT PromoterAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRevTRE MKL1-N100 S449A/T450A/S454A
Plasmid#19849DepositorInsertMKL1-N100 S449A/T450A/S454A (MRTFA Human)
UseRetroviralTags3xFLAGMutationdeleted amino acids 1-100 and changed Serine 449,…Available SinceFeb. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
Gal1/10 His6-MBP TEV Ura S. cerevisiae expression vector (12URA-C)
Plasmid#48305DepositorTypeEmpty backboneUseNaTagsHis6 and MBPAvailable SinceNov. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
m6A-Tracer-NES
Plasmid#159607PurposeConstitutive transient mammalian expression of m6A-Tracer protein (Kind et al. 2013) with a C-terminal HIV-1 Rev Nuclear Export Signal to reduce background due to nonspecific DNA interactions.DepositorInsertm6A-Tracer-NES
ExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Rev7-Halo HRD
Plasmid#207079PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous REV7 locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human REV7 locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Brevican scFv [N294A/6]
Plasmid#206772PurposeMammalian Expression of Brevican scFV. Derived from hybridoma N294A/6 scFv.DepositorAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-Brevican [N294A/6]
Plasmid#190309PurposeMammalian Expression Plasmid of anti-Brevican (Rat). Derived from hybridoma N294A/6.DepositorInsertanti-Brevican (Rattus norvegicus) recombinant Mouse monoclonal antibody (Bcan Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT5T_Rev7_1-211_SA112_KVK_Champ1_328-355
Plasmid#105638PurposeExpresses mouse monomeric Rev7 and fragment of Champ1 protein (amino acids 328-355) from bicistronic plasmidDepositorExpressionBacterialMutationMutations: F11S, G12A, V132K, C133V, A135KPromoterT7Available SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRevA-TEV-His12
Plasmid#137034Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi RevA with C-terminal TEV-protease-cleavable His12DepositorInsertAAF07416.1 (revA Borrelia burgdorferi B31)
TagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-JeT-pmRevErbA-Venus-NLS-Pest
Plasmid#240106PurposeA lentiviral (yellow) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by synthtic JeT promoter.DepositorInsertmurine Nr1d1 promoter+Venus-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded JeT PromoterAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-pSV40(1)-pmRevErbA-Venus-NLS-Pest
Plasmid#240112PurposeA lentiviral (yellow) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by SV40 promoter fragment.DepositorInsertmurine Nr1d1 promoter+Venus-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded SV40-EnhancerAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-pSV40(1)-pmRevErbA-mScaI3-NLS-Pest
Plasmid#240116PurposeA lentiviral (red) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by SV40 promoter fragment.DepositorInsertmurine Nr1d1 promoter+mScarlet-I3-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded SV40-EnhancerAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-rev(CMV-TagBFP2)-EFS-mCherry-124-MUT-MRE
Plasmid#235148PurposeExpresses the mCherry-based mutated (control) sensor for miR-124. TagBFP2 is expressed as a transduction reporterDepositorInsertmCherry with a mutated miR-124 MRE
UseAAVMutation7 nucleotides of the miR-124 WT MRE mutatedPromoterEFSAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
Gal1/10 His6 TEV Trp S. cerevisiae expression vector (12TRP-B)
Plasmid#48301DepositorTypeEmpty backboneUseNaTagsHis6Available SinceNov. 5, 2013AvailabilityAcademic Institutions and Nonprofits only