We narrowed to 17,159 results for: REV
-
Plasmid#65343Purposesysthesis of crtYB gene in the beta-carotene pathwayDepositorInsertycrtYB
UseSynthetic BiologyAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
PMV-ycrtE
Plasmid#65341Purposesysthesis of crtE gene in the beta-carotene pathwayDepositorInsertycrtE
UseSynthetic BiologyAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
SNAP-EF(N)-5nmSAH-GFP(1-10)
Plasmid#61659Purpose5nm SAH scaffold with EF Hand and split GFP attachment sitesDepositorInsertSNAP-EF(N)-5nmSAH-GFP(1-10)
ExpressionMammalianAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
SNAP-EF(N)-10nmSAH-GFP(1-10)
Plasmid#61660Purpose10nm SAH scaffold with EF Hand and split GFP attachment sitesDepositorInsertSNAP-EF(N)-10nmSAH-GFP(1-10)
ExpressionMammalianAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAsylum
Plasmid#24754DepositorTypeEmpty backboneUseCloning vectorAvailable SinceJune 21, 2010AvailabilityAcademic Institutions and Nonprofits only -
pYSD153
Plasmid#212929PurposeEncodes the mRuby2 fluorescent protein (Part3b') with the 111AA SCW4 TFP (Part3a') assembled with S. cerevisiae pTEF1 promoter, tTDH1 terminator, LEU2 selectable marker and CEN/ARS yeast origin.DepositorInsertmRuby2
ExpressionYeastAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD141
Plasmid#212928PurposeEncodes the mRuby2 fluorescent protein (Part3b') with the Aga2 signal peptide (Part3a') assembled with S. cerevisiae pTEF1 promoter, tTDH1 terminator, LEU2 selectable marker and CEN/ARS yeast origin.DepositorInsertmRuby2
ExpressionYeastAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
KBB364
Plasmid#185083PurposeRFA1 fused to GFP under control of GAL1 promoterDepositorInsertRFA1
TagsGFPExpressionYeastPromoterGAL1Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
CDC12(K351N)
Plasmid#1163DepositorAvailable SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
GAL-CDC12(K351N)
Plasmid#1166DepositorAvailable SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRS426-GFP-Osh2-PH
Plasmid#71373PurposeFor analysis of PH domain localization in yeastDepositorInsertOsh2-PH
TagsEGFPExpressionYeastMutationPleckstrin homology (PH) domain; aa 277-398Available SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
UASGAL-CU2-Pleum
Plasmid#60328PurposeContains a promoter comprised of derivatives from native promoters galactose, cyc and leucine.DepositorInsertpromoter
UseSynthetic Biology; Yeast synthetic hybrid promoteā¦ExpressionYeastAvailable SinceNov. 6, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHIS3p:Venus-Tub1+3'UTR::TRP1
Plasmid#50650DepositorInsertVenus-Tub1
UseYeast expressionTagsVenusPromoterHIS3pAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHIS3p:CloverGFP-Tub1+3'UTR::TRP1
Plasmid#50648DepositorInsertCloverGFP-Tub1
UseYeast expressionTagsCloverGFPPromoterHIS3pAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHIS3p:mEos2-Tub1+3'UTR::LEU2
Plasmid#50646DepositorInsertmEos2-Tub1
UseYeast expressionTagsmEos2PromoterHIS3pAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHIS3p:yomWasabi-Tub1+3'UTR::LEU2
Plasmid#50643DepositorInsertyomWasabi-Tub1
UseYeast expressionTagsyomWasabiPromoterHIS3pAvailable SinceDec. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
Gal-Rad51 KR
Plasmid#33232DepositorAvailable SinceFeb. 7, 2012AvailabilityAcademic Institutions and Nonprofits only