We narrowed to 5,433 results for: dre
-
Plasmid#184535PurposeshRNA expression vectorDepositorAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only
-
shTRIP13-1
Plasmid#184536PurposeshRNA expression vectorDepositorAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
shTRIP13-2
Plasmid#184537PurposeshRNA expression vectorDepositorAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
KChIP3 K+ channel scFv [K66/27]
Plasmid#206760PurposeMammalian Expression of KChIP3 K+ channel scFV. Derived from hybridoma K66/27 scFv.DepositorInsertKChIP3 K+ channel (Rattus norvegicus) recombinant scFV (Kcnip3 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
KChIP3 K+ channel scFv [K66/38]
Plasmid#206761PurposeMammalian Expression of KChIP3 K+ channel scFV. Derived from hybridoma K66/38 scFv.DepositorInsertKChIP3 K+ channel (Rattus norvegicus) recombinant scFV (Kcnip3 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
KChIP3 K+ channel scFv [K66/59]
Plasmid#206762PurposeMammalian Expression of KChIP3 K+ channel scFV. Derived from hybridoma K66/59 scFv.DepositorInsertKChIP3 K+ channel (Rattus norvegicus) recombinant scFV (Kcnip3 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-CSRNP2-P2A-mCherry
Plasmid#203867PurposeTet-inducible lentiviral plasmid expressing CSRNP2-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertCSRNP2 (CSRNP2 Human)
ExpressionMammalianAvailable SinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-KChIP3 K+ channel [K66/59]
Plasmid#190285PurposeMammalian Expression Plasmid of anti-KChIP3 K+ channel (Rat). Derived from hybridoma K66/59.DepositorInsertanti-KChIP3 K+ channel (Rattus norvegicus) recombinant Mouse monoclonal antibody (Kcnip3 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-KChIP3 K+ channel [K66/27]
Plasmid#190284PurposeMammalian Expression Plasmid of anti-KChIP3 K+ channel (Rat). Derived from hybridoma K66/27.DepositorInsertanti-KChIP3 K+ channel (Rattus norvegicus) recombinant Mouse monoclonal antibody (Kcnip3 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSC-CMV-HA-Ast-3-NP-1-IRES-mCherry
Plasmid#159631Purposeexpresses HA Allatostatin-3, Neurophysin-1, IRES mCherry under the CSC promoterDepositorInsertAst (AstA Fly)
UseLentiviralTagsHA, IRES, mCherry, and neurophysin-1ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEAHISSOarD1
Plasmid#97067PurposeExpressing Sulfolobus solfataricus orf Sso Ard1 (N-terminal acetylase) proteinDepositorInsertS. solfataricus Sso Ard1 protein
TagsN-terminal TEV protease cleavable 6xHis tagMutationnonePromoterT7Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEAHISSIRV131
Plasmid#97053PurposeExpressing Sulfolobus islandicus rudivirus (SIRV) orf 131 proteinDepositorInsertSIRV orf 131
TagsN-terminal TEV protease cleavable 6xHis tagExpressionBacterialMutationnonePromoterT7Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEAHISSIRV418/gp25
Plasmid#97052PurposeExpressing Sulfolobus islandicus rudivirus (SIRV) orf 418/gp25 proteinDepositorInsertSIRV orf 418/gp25
TagsN-terminal TEV protease cleavable 6xHis tagExpressionBacterialMutationnonePromoterT7Available SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ADRBK1
Plasmid#23835DepositorInsertADRBK1 (GRK2 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-Gq-P2A-dTomato
Plasmid#135635PurposeAAV vector to drive the expression of Gq-DREADD-P2A-dTomato in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGq-P2A-dTomato
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag ADRBK1
Plasmid#20418DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only