We narrowed to 9,676 results for: control
-
Plasmid#223533PurposeMammalian expression of CHMP3 fused to the hepatitis C virus protease NS3 through a short linker containing the NS3 cleavage site, along with a blue fluorescent protein.DepositorInsertCHMP3 (CHMP3 Human)
TagsNS3 Hepatitis C protease and mTurquoiseExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHMP3-mut-NS3-Green
Plasmid#223530PurposeMammalian expression of CHMP3 fused to the hepatitis C virus protease NS3 through a short linker containing mutated NS3 cleavage site, along with a green fluorescent protein.DepositorInsertCHMP3 (CHMP3 Human)
TagsNS3 Hepatitis C protease and mNeonGreenExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHMP2A-mut-NS3-Green
Plasmid#223529PurposeMammalian expression of CHMP2A fused to the hepatitis C virus protease NS3 through a short linker containing a mutated NS3 cleavage site, along with a green fluorescent protein.DepositorInsertCHMP2A (CHMP2A Human)
TagsNS3 Hepatitis C protease and mNeonGreenExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHMP3-NS3-Green
Plasmid#223527PurposeMammalian expression of CHMP3 fused to the hepatitis C virus protease NS3 through a short linker containing the NS3 cleavage site, along with a green fluorescent protein.DepositorInsertCHMP3 (CHMP3 Human)
TagsNS3 Hepatitis C protease and mNeonGreenExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
neg.ctrl_pSTC0-zeo
Plasmid#202350PurposeControl neg. ctrl (negative control S70A) in modified pSTC0 vector in which kan resistance cassette is replaced with zeo resistance cassetteDepositorInsertneg. ctrl
Available SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-RepoMan-T394A
Plasmid#204994PurposeExpresses shRNA resistant GFP-RepoMan T394A MutantDepositorInsertcell devision cycle associated 2 (CDCA2 Human)
TagsGFPExpressionMammalianMutationchanged Threonine 394 to AlaninPromoterCMVAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-RepoMan-S893D
Plasmid#204995PurposeExpresses shRNA resistant GFP-RepoMan S893D MutantDepositorInsertcell division cycle associated 2 (CDCA2 Human)
TagsGFPExpressionMammalianMutationchanged Serine 893 to Aspartic acidPromoterCMVAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-RepoMan-RATA
Plasmid#184270PurposeExpresses shRNA resistant GFP-RepoMan RATA MutantDepositorInsertcell division cycle associated 2 (CDCA2 Human)
Tags3xHA and GFPExpressionMammalianMutationV383A, F395APromoterCMVAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Repo-Man-1-890
Plasmid#184272PurposeExpresses C-terminally truncated GFP-RepoManDepositorInsertcell division cycle associated 2 (CDCA2 Human)
TagsGFPExpressionMammalianMutationtruncated Repo-Man after aminoacid 893PromoterCMVAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-NLS-msfGFP-T2A-mCherry-NES> mPGK-PuroR
Plasmid#218916PurposeLentiviral construct expressing msfGFP and nuclear mCherry proteins.DepositorInsertEF1a-msfGFP-T2A-mCherry-NLS > mPGK-PuroR
UseLentiviralAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_131
Plasmid#216095PurposeCas12a [EnAs] CRISPRa targeting CD97, CD4, CD26, CD274, positive controlDepositorInsertCD97, CD4, CD26, CD274 guides
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FKBP-GFP-NAP1-S37K/A44E (delta-NDP52)
Plasmid#208863PurposeStably express GFP-tagged NAP1 (delta-NDP52) for CID induced mitophagyDepositorInsertNAP1 (AZI2 Human)
TagsFKBP-GFPExpressionMammalianMutationS37K/A44E (disrupts NDP52 binding)Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FKBP-GFP-NAP1-I11S/L12S (delta-FIP200)
Plasmid#208864PurposeStably express GFP-tagged NAP1 (delta-FIP200) for CID induced mitophagyDepositorInsertNAP1 (AZI2 Human)
TagsFKBP-GFPExpressionMammalianMutationI11S/L12S (disrupts FIP200 binding)Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FKBP-GFP-NAP1-L226Q/L233Q (delta-TBK1)
Plasmid#208865PurposeStably express GFP-tagged NAP1 (delta-TBK1) for CID induced mitophagyDepositorInsertNAP1 (AZI2 Human)
TagsFKBP-GFPExpressionMammalianMutationL226Q/L233Q (disrupts TBK1 binding)Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Synapsin-SspB-EGFP-VP16-P2A-FLAG-TetR-NLS-CapN-SsrA-CapC
Plasmid#213535PurposeExpresses the split transcription factors in cultured neuron and mouse brainDepositorInsertSspB-EGFP-VP16-P2A-FLAG-TetR-NLS-CapN-SsrA-CapC-HA-HA
UseAAVTagsEGFP and HAExpressionMammalianPromoterSynapsinAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CTRL00509)-PGKpuroBFP-W
Plasmid#211956PurposeExpress non-cutter control gRNA with puro and BFPDepositorInsertnon-cutter control sgRNA_CTRL00509
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CTRL00626)-PGKpuroBFP-W
Plasmid#211957PurposeExpress non-cutter control gRNA with puro and BFPDepositorInsertnon-cutter control sgRNA_CTRL00626
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti4/V5-DEST-AERRIE
Plasmid#204023PurposeLentiviral vector expressing human long non-coding RNA AERRIE (linc01013)DepositorAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
tetO-Fzd1-IRES-tdTomato (TET006)
Plasmid#160510PurposeThis plasmid expresses Fzd1 under the activation of tTA trans-activator along with fluorescent marker tdTomato.DepositorArticleInsertFzd1 (Fzd1 Mouse)
ExpressionMammalianAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only