We narrowed to 6,784 results for: mCherry
-
Plasmid#190607PurposeExpresses a gRNA for base editing the EGFP Kozak sequence of pWPT-/mEGFP-1T-IRES-mCherryDepositorInsertgRNA sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pACE-GIRK2-mC-S
Plasmid#172428PurposeExpression of full-length, human GIRK4 with C-terminal mCherry StrepTag IIDepositorAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
attB53_SNCB-_attB53
Plasmid#183615PurposeRMCE vector to shuttle puromycin resistance (+), anti-GFP SynNotch receptor (+), tagBFP (-) and TRE-mCherry (-) cassettes into attP50-flanked landing pad (Addgene 183609). (+) = sense (-) = antisense.DepositorInsertsLaG17 GFP nanobody SynNotch tTA
TRE-mCherry-SV40pA
tagBFP
UseRmceTagsMyc and human CD8a signal sequenceExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
pSR11
Plasmid#69154Purposeread-outloxP mCherry to GFP switch, with fzr-1 promoter, gene and UTR, for integration on cxtTi10816, Mos Chr IVDepositorInsertsUseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterfzr-1 and rps-27Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d23
Plasmid#59892Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with two seed sites mutatedDepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd and fourth seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d3
Plasmid#59891Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with one seed site mutated.DepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDOE20 mC VN
Plasmid#124246PurposeAllows fluorescent (mVENUS; mCherry) co-localization of two proteins in Agrobacterium- transformed plant cells.DepositorTypeEmpty backboneExpressionPlantAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDOE20 mC VN transient
Plasmid#124247PurposeAllows fluorescent (mVENUS; mCherry) co-localization of two proteins in directly-transfected plant cells.DepositorTypeEmpty backboneExpressionPlantAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
mCh-Drp1
Plasmid#49152Purposemammalian expression of Drp1 fused to mCherryDepositorAvailable SinceNov. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV-15F11-HA-mCh
Plasmid#129591PurposeThe encoded protein is the anti-HA scFv (anti-HA frankenbody) fused with the mCherry. It can be used to track mature and nascent HA tagged proteins in living organism.DepositorInsertAnti-HA frankenbody-mCherry (15F11-HA scFv-mCh)
ExpressionMammalianPromoterCMVAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-opto-hCaspase-4 dCARD
Plasmid#208785PurposeInducibly expresses human Caspase 4 lacking the CARD domain, fused to light-activatable Cry2DepositorInsertCry2 mCherry Caspase4 dCARD (CASP4 Human)
UseLentiviralTagsCry2 mCherryExpressionMammalianMutationCARD domain is removedAvailable SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
B1-INTEGRIN WT
Plasmid#195215PurposeMammalian expression of mCherry tagged B1 Integrin. Wild-type.DepositorInsertITGB1 (ITGB1 Human)
ExpressionMammalianAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Akt-STOPS
Plasmid#175006PurposeAkt Substrate-based Tandem Occupancy Peptide Sponge. Genetically encoded for perturbing cellular Akt kinase activity.DepositorInsertmCherry-Akt-STOPS
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCh-BICD2*-strep
Plasmid#120168PurposeExpresses a chimera of mCherry (fluorescent tag), a BICD2-based adaptor and streptavidinDepositorInsertBICD cargo adaptor 2 (Bicd2 Mouse)
TagsStreptavidin and mCherryExpressionMammalianMutationTruncated BICD2: 15-595 aaPromoterCMVAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNBA002
Plasmid#155324PurposeBinary vector for expression of PULSE-controlled GBP-mCherryDepositorInsertLB_(etr)8-(C120)5-PhCMVmin-GBP-mCherry-T35S_RB
UseSynthetic Biology; Eukaryotic expressionAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pH3mCHSH2
Plasmid#101053PurposeThis is a Cryptococcus neoformans mCherry expression vector with G418 drug selection marker and C. neoformans SH2 flanking sequences for genome integration.DepositorInsertCryptococcus mCherry expression plasmid
ExpressionYeastPromoterCryptococcus Histone3 promoterAvailable SinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
2xFKBP-mCh-KDEL
Plasmid#173010PurposeFKBP anchor for retaining DHFR-fused cargoes in the ER in the presence of zapalog. Encodes ER retrieval motif (KDEL) at C-terminus of mCherry. Contains IRES following ORF for cloning cargo.DepositorInsert2xFKBP-mCh-KDEL
TagsmCherryExpressionMammalianPromoterChicken beta actin (CAG)Available SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only