We narrowed to 11,743 results for: 110
-
Plasmid#158622PurposeDonor plasmid for tagging DHC1 with AID-CloverDepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPR; Tagging donorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk3_#2-puro
Plasmid#231982PurposeKnockout mouse Ripk3DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk3 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk3_#1-puro
Plasmid#231981PurposeKnockout mouse Ripk3DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk3 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
hKCNQ3(WT).ires.mCherry-pcDNA3
Plasmid#204362PurposeHeterologous expression in mammalian cell lines or Xenopus oocyte (T7 RNA pol)DepositorAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
NanoLuc-KRAS(G12D)_CRAF(FL)-HaloTag BiBRET Vector
Plasmid#238579PurposeExpress NanoLuc-KRAS(G12D)_CRAF(FL)-HaloTag Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationG12DPromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBOB-CAG-SARS-CoV2-Spike-HA
Plasmid#141347Purpose3rd Generation lentiviral vector expressing the codon-optimized SARS-CoV2 Spike Glycoprotein ORF with a C-terminal HA tag generated by Junko Ogawa & Gerald M PaoDepositorInsertSARS-CoV2 Spike Glycoprotein (S SARS-CoV2 hCoV19_USA EPI_ISL_414366 (GISAID))
UseLentiviralTagsHAMutationresynthesized with human codon optimization nucle…PromoterCAGAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Neo-M2rtTA
Plasmid#60843PurposeAAVS1 donor vector for genomic targetingDepositorInsertsM2rtTA
Neo
UseTargeting donorAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-CBA-dt/PGK-CFTR-⌀
Plasmid#163923PurposeExpresses human CFTR.DepositorAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_dHMGA_mKate2_CLEAVAGE
Plasmid#167337PurposeExpresses mKate2 fused to TFAM dHMGA mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationTruncation mutant containing MTS (1-42) as well a…PromoterCMVAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac-TetO-Lmx1a-t2a-Pitx3-puro
Plasmid#176484PurposeTetO-Lmx1a-t2a-Pitx3 in a PiggyBac vector with puromycin resistanceDepositorAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-830_HA-GD2-28z_CAR_tNGFR_Retroviral
Plasmid#207507PurposeThis plasmid can be used to generate retrovirus.DepositorInserttNGFR, HA-GD2-28z_CAR (NGFR Human)
UseRetroviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF0751
Plasmid#143729PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Flag_HsIRE1a_deltaP29_D408_pBabePuro
Plasmid#58422Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant human IRE1a deleted from amino acids P28 to D408DepositorInsertIRE1a (ERN1 Human)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationDeleted amino acids P29 to D408Available SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
AttB_ACE2-2A-TMPRSS2_IRES_iRFP670-H2A-P2A-PuroR
Plasmid#190077Purposeexpress human ACE2 and human TMPRSS2 with selectable markers iRFP670 and puromycin resistance geneDepositorAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3_c-MYC
Plasmid#26818DepositorInsert5'UTR-c-MYC-3'UTR (MYC Human)
ExpressionMammalianMutationSequence begins from second ATG; Synthetic UTR se…Available SinceNov. 17, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-DmrB-DmrB-Ripk3-2A-mCherry-puro
Plasmid#231972PurposeTet inducible expression of DmrB-Ripk3 with mCherry to induce Ripk3 necroptosisDepositorInsertRipk3-deltaC dimerizing construct with bi-cistronic mCherry (Ripk3 Mouse)
UseLentiviralMutationWTAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
P210 pcDNA3
Plasmid#27481DepositorExpressionMammalianMutationContains the complete bcr/abl fusionPromoterCMVAvailable SinceMarch 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
TFORF0391
Plasmid#143211PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only