We narrowed to 2,687 results for: fas
-
Plasmid#167150PurposeMoClo-compatible Level 1 (position 1) vector encoding Kanamycin resistance cassette, for expression in plantsDepositorInsertpNOS-nptII-ocsT
UseTagsExpressionPlantMutationPromoterpNOSAvailable sinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX022
Plasmid#167148PurposeMoClo-compatible Level 0-CDS2 promoterless vector encoding C-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertC-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX021
Plasmid#167147PurposeMoClo-compatible Level 0-SP promoterless vector encoding N-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertN-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-control
Plasmid#213788PurposeCIRTS RNA targeting system for targeted knockdown in neurons. CIRTS-Calm3 and scramble control guide RNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-Calm3-U6-control gRNA
UseLentiviralTagsGFPExpressionMammalianMutationPromoterSyn1, U6Available sinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNCS-mGold2t
Plasmid#231766PurposeExpression of mGold2t in bacterial cellsDepositorInsertmGold2t
UseTagsExpressionBacterialMutationmGold2t is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterSynthetic promoterAvailable sinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-Gas5
Plasmid#213172PurposeCIRTS RNA targeting system for targeted knockdown in neurons. CIRTS-Calm3 and Gas5 guide RNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-Calm3-U6-Gas5 gRNA
UseLentiviralTagsGFPExpressionMammalianMutationPromoterSyn1, U6Available sinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-N1 GBP (GBP-mEos2)
Plasmid#162876PurposeExpression in mammalian cells of GFP binding protein (GBP) tagged with photoconvertable protein mEos2 to track GFP proteins of interest to perform Fluorescent intrabody Localization MicroscopyDepositorInsertGFP Binding Protein tagged with mEos2
UseTagsmEos2ExpressionMammalianMutationPromoterAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mG2b-srt-his
Plasmid#124804PurposeHDR template to knock-in mouse IgG2b Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG2b producing cell lines.DepositorInsertMurine IgG2b
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianMutationPromoterAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mG2a-srt-his
Plasmid#124803PurposeHDR template to knock-in mouse IgG2a Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG2a producing cell lines.DepositorInsertMurine IgG2a
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianMutationPromoterAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459-gR2A_Hinge
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mG1-srt-his
Plasmid#124802PurposeHDR template to knock-in mouse IgG1 Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG1 producing cell lines.DepositorInsertMurine IgG1
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianMutationPromoter-Available sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mA-srt-his
Plasmid#124806PurposeHDR template to knock-in mouse IgA Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgA producing cell lines.DepositorInsertMurine IgA
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianMutationPromoterAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mG3-srt-his
Plasmid#124805PurposeHDR template to knock-in mouse IgG3 Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG3 producing cell lines.DepositorInsertMurine IgG3
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianMutationPromoterAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCaggs-mGold2t
Plasmid#231764PurposeExpression of mGold2t in mammalian cellsDepositorInsertmGold2t
UseTagsExpressionMammalianMutationmGold2t is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterActin promoter with CMV enhancerAvailable sinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL-mGold2t
Plasmid#231762PurposeExpression of mGold2t in yeast cellsDepositorInsertmGold2t
UseTagsExpressionYeastMutationmGold2t is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterpTDH(GAP promoter)Available sinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCPF101-pfQC-cyclase dead
Plasmid#184878Purposeexpresses soluble plasmodium falciparum QC protein with a histag, cyclase dead mutantDepositorInsertpfQC-cyclase dead
UseTagsHis tagExpressionBacterialMutationF77A & Q79APromoterAvailable sinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBlue-hFX(I154F)-HA
Plasmid#14988DepositorInserthuman frataxin cDNA (FXN Human)
UseTagsAU1 and HAExpressionBacterialMutationchanged isoleucine 154 to phenylalaninePromoterAvailable sinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBlue-hFX(T133A)-HA
Plasmid#14989DepositorInserthuman frataxin cDNA (FXN Human)
UseTagsAU1 and HAExpressionBacterialMutationchanged threonine 133 to alaninePromoterAvailable sinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBlue-hFX(T133E)-HA
Plasmid#14990DepositorInserthuman frataxin cDNA (FXN Human)
UseTagsAU1 and HAExpressionBacterialMutationchanged threonine 133 to glutamic acidPromoterAvailable sinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBlue-hFX-HA(AscI)
Plasmid#15404DepositorInserthuman frataxin cDNA (FXN Human)
UseTagsAU1 and HAExpressionBacterialMutation700 bp insert can be released by digestion with r…PromoterAvailable sinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-N1 PH-PLCd (wild-type) (PH-PLCd-mEos2)
Plasmid#162877PurposeExpression in mammalian cells of Plekstrin-homology domain of Phospholipase C delta tagged with mEos2 to perform sptPALMDepositorInsertpleckstrin homology domain of PLCδ1 (phospholipase C-δ1) (PLCD1 Human)
UseTagsmEos2ExpressionMammalianMutationInsert consists of AA1-170PromoterAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 PA-PLA1 (EGFP-PA-PLA1)
Plasmid#162880PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with EGFPDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
UseTagsEGFPExpressionMammalianMutationPromoterAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>m2a(silent)-srt-his
Plasmid#124807PurposeHDR template to knock-in FC silent mIgG2a isotype in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to FC silent producing cell lines.DepositorInsertMurine IgG2a (Fc silent)
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianMutationL234A/L235A/N297APromoterAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>Fab-srt-his
Plasmid#124810PurposeHDR template to knock-in sortag and histag in rat IgG2a heavy chain locus. Use in combination with PX459-gR2A_Hinge to convert rat IgG2a hybridoma to Fab' fragment producing cell lines.DepositorInsertrat IgG2a Hinge-G4S-Sortag-Histag
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterialMutationPromoterpUCAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBlue-hFX-HA(NcoI/EcoRI)
Plasmid#15405DepositorInserthuman frataxin cDNA (FXN Human)
UseTagsAU1 and HAExpressionBacterialMutationinsert can be released by digestion with REs NcoI…PromoterAvailable sinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pGL3-basic-hFX-promotor(2kb, distal)
Plasmid#14981DepositorInserthuman frataxin promoter fragment (FXN Human)
UseLuciferaseTagsExpressionMutationincludes distal fragment of human frataxin promot…PromoterAvailable sinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
FXN_Halo_N_allele
Plasmid#178141PurposeDonor vector for endogenous tagging of human FXN at the N-terminus with halotagInsertHalotag (FXN Human)
UseDonor vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2021AvailabilityAcademic Institutions and Nonprofits only