We narrowed to 14,045 results for: crispr grnas
-
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hEGFR_2b)-PGKpuro2ABFP-W
Plasmid#208432PurposeLentiviral gRNA plasmid targeting human EGFR gene, co-expression of BFP tagDepositorInsertEGFR (EGFR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hRNF31_2b)-PGKpuro2ABFP-W
Plasmid#208415PurposeLentiviral gRNA plasmid targeting human RNF31 gene, co-expression of BFP tagDepositorInsertRNF31 (RNF31 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hXIAP_1k)-PGKpuro2ABFP-W
Plasmid#208420PurposeLentiviral gRNA plasmid targeting human XIAP gene, co-expression of BFP tagDepositorInsertXIAP (XIAP Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hXIAP_2b)-PGKpuro2ABFP-W
Plasmid#208421PurposeLentiviral gRNA plasmid targeting human XIAP gene, co-expression of BFP tagDepositorInsertXIAP (XIAP Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMTOR_1k)-PGKpuro2ABFP-W
Plasmid#208429PurposeLentiviral gRNA plasmid targeting human MTOR gene, co-expression of BFP tagDepositorInsertMTOR (MTOR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMTOR_2b)-PGKpuro2ABFP-W
Plasmid#208430PurposeLentiviral gRNA plasmid targeting human MTOR gene, co-expression of BFP tagDepositorInsertMTOR (MTOR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hEGFR_1k)-PGKpuro2ABFP-W
Plasmid#208431PurposeLentiviral gRNA plasmid targeting human EGFR gene, co-expression of BFP tagDepositorInsertEGFR (EGFR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hRNF31_1k)-PGKpuro2ABFP-W
Plasmid#208414PurposeLentiviral gRNA plasmid targeting human RNF31 gene, co-expression of BFP tagDepositorInsertRNF31 (RNF31 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTBL3331 MTK234-TetO-AtoBpegRNA
Plasmid#226668PurposeMTK234 part containing tet-inducible variant of the hU6 promoter driving an A to B pegRNADepositorInserthU6-TetO-AtoBpegRNA
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6-TetOAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-(BB)-2A-Puro-HsHelz-sgRNA_AH
Plasmid#148897PurposeMammalian Expression of HsHelz-sgRNADepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
hU6-DR_BsmBI_DR-EFS-RfxCas13d-NLS-2A-Puro-WPRE CasRx pre-gRNA backbone
Plasmid#219823PurposeEF1α-driven expression of RfxCas13d in mammalian cells. For cloning of pre-guide RNAs compatible with RfxCas13d. Contains a 5' direct repeat. Clone using BsmBI. (Adapted from plasmid #138147)DepositorInsertRfxCas13d
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core promoterAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6gRNA1-U6gRNA2-TnT-Cre
Plasmid#87682PurposeAAV vector for U6 driven expression of two gRNAs, and cardiomyocyte specific expression of Cre recombinase.DepositorInsertsgRNA1
gRNA2
Cre
UseAAVPromoterU6 and cTnTAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDY2261 hACTB atgRNA Paired Guide 1
Plasmid#220991PurposehACTB atgRNADepositorInsertACTB atgRNA (ACTB Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY2262 hACTB atgRNA Paired Guide 2
Plasmid#220992PurposehACTB atgRNADepositorInsertACTB atgRNA (ACTB Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY2259 hNOLC1 atgRNA Paired Guide 1
Plasmid#220989PurposehNOLC1 atgRNADepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY2260 hNOLC1 atgRNA Paired Guide 2
Plasmid#220990PurposehNOLC1 atgRNADepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPW3754 : pUC-SpCas9_gRNA-HsIRE1-Cterm
Plasmid#185676PurposeSpCas9 and gRNA targeting the C-terminus of HsIRE1DepositorInsertERN1 gRNA (ERN1 Human)
UseCRISPRAvailable SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
783-Rx-mU6: RfxCas13d gRNA and array cloning backbone
Plasmid#228361PurposemU6-driven expression of RfxCas13d gRNAs and arrays. Contains AarI sites for guide cloning.DepositorTypeEmpty backboneUseCRISPR and Lentiviral; Rfxcas13d grna expression …ExpressionMammalianPromotermU6Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only