We narrowed to 11,070 results for: AGA
-
Plasmid#99304PurposeLuciferase validation vector with GTSE1 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr22: 46718429 -46719913
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_SCP1_GTSE1
Plasmid#99305PurposeLuciferase validation vector with GTSE1 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr22: 46718429 -46719913
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN103
Plasmid#91630PurposeExpress sgRNA targeting human IMMP2LDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_mP_IGF1R
Plasmid#99307PurposeLuciferase validation vector with IGF1R enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr15: 99439352 -99440791
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_SCP1_IGF1R
Plasmid#99308PurposeLuciferase validation vector with IGF1R enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr15: 99439352 -99440791
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-HSPE-sh2
Plasmid#92034PurposepSIREN-RetroQ vector containing shRNA sequence to HPSEDepositorInsertshRNA #2 to HPSE (Hpse Mouse)
UseRetroviralAvailable SinceJuly 19, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
TTBK2 gRNA (BRDN0001148497)
Plasmid#77971Purpose3rd generation lentiviral gRNA plasmid targeting human TTBK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PHKA2 gRNA (BRDN0001146948)
Plasmid#77844Purpose3rd generation lentiviral gRNA plasmid targeting human PHKA2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
POMK gRNA (BRDN0001144851)
Plasmid#77761Purpose3rd generation lentiviral gRNA plasmid targeting human POMKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PFKFB1 gRNA (BRDN0001147285)
Plasmid#77630Purpose3rd generation lentiviral gRNA plasmid targeting human PFKFB1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PFKFB1 gRNA (BRDN0001162492)
Plasmid#77632Purpose3rd generation lentiviral gRNA plasmid targeting human PFKFB1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TAOK2 gRNA (BRDN0001148565)
Plasmid#77249Purpose3rd generation lentiviral gRNA plasmid targeting human TAOK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PNKP gRNA (BRDN0001149048)
Plasmid#77163Purpose3rd generation lentiviral gRNA plasmid targeting human PNKPDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PLXNA3 gRNA (BRDN0001145544)
Plasmid#77089Purpose3rd generation lentiviral gRNA plasmid targeting human PLXNA3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKCH gRNA (BRDN0001149082)
Plasmid#76915Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCHDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NTPCR gRNA (BRDN0001147742)
Plasmid#76877Purpose3rd generation lentiviral gRNA plasmid targeting human NTPCRDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PI4KA gRNA (BRDN0001145538)
Plasmid#76817Purpose3rd generation lentiviral gRNA plasmid targeting human PI4KADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PI4KA gRNA (BRDN0001147752)
Plasmid#76819Purpose3rd generation lentiviral gRNA plasmid targeting human PI4KADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only