We narrowed to 3,249 results for: cat.3
-
Plasmid#242185PurposeExpress doxycycline inducible UCE 32S binding mutation of CRNDE in mammalian cellsDepositorInsertCRNDE UCE mutant (CRNDE Human)
ExpressionMammalianMutationATTTTCATGGGC to TAAAAGTACCCGPromoterTRE3GSAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
ELL2mRNA+polyA
Plasmid#127256PurposeFor in vitro translation of human ELL2 with 30 nt pA tailDepositorInsertELL2 (ELL2 Human)
UseIn vitro translationMutationshortens 3'UTR to 40 bp adds A30 tailPromoterT7Available SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-cfSec15A_5
Plasmid#26716DepositorInsertDog Sec15A RNAi (EXOC6 C. familiaris (dog RNAi))
UseLentiviral and RNAiExpressionMammalianMutationDog Sec15A-specific RNAi.Available SinceDec. 15, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-shGrm2-2344
Plasmid#120725PurposeLentiviral vector that expresses GFP and an shRNA targeting Grm2 (in pLL3.7)DepositorAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF2
Plasmid#106102PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF2DepositorInsertgRNA targeting CELF2 (CELF2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJFRC7-JEDI-2P
Plasmid#179461PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P under the promoter hsp70 for Drosophila (insect) expressionDepositorInsertJEDI-2P
ExpressionInsectPromoterhsp70Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Puro-CAG-JEDI-2P
Plasmid#179458PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P expressed under strong mammalian promoter (CAG)DepositorInsertJEDI-2P
ExpressionMammalianPromoterCAGAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI-2P-WPRE
Plasmid#179464PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for neuron -specific expression using the promoter hSynDepositorHas ServiceAAV9InsertJEDI-2P
UseAAVExpressionMammalianPromoterhSynAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-JEDI-2P-WPRE
Plasmid#179469PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for astrocytes specific expression using the promoter GFAPDepositorInsertJEDI-2P
UseAAVExpressionMammalianPromoterGFAPAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only