We narrowed to 14,517 results for: SHR;
-
Plasmid#184535PurposeshRNA expression vectorDepositorAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only
-
shTRIP13-1
Plasmid#184536PurposeshRNA expression vectorDepositorAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
shTRIP13-2
Plasmid#184537PurposeshRNA expression vectorDepositorAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX304-BCL-XL-499/500R
Plasmid#203575PurposeExpresses V5-tagged BCL-XL with resistance to shRNA (TRCN0000033499, TRCN0000033500) in mammalian cells.DepositorInsertBCL2L1 (BCL2L1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationsilent point mutations to make resistant shRNA 49…PromoterCMVAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO shLuc/FLAG Metap2
Plasmid#209316PurposeLentiviral construct expressing FLAG Metap2 and shRNA against Luciferase (control shRNA)DepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO shLYCHOS/LYCHOS WT-FLAG
Plasmid#209315PurposeLentiviral construct expressing shRNA against LYCHOS and LYCHOS WT-FLAG (resistant to shRNA)DepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
sh2g-ZMYND8-human
Plasmid#201406PurposeKnockdown of Zinc Finger MYND Type-8. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertZMYND8 (ZMYND8 Human)
ExpressionMammalianAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
sh4p-ZMYND8-mouse
Plasmid#201405PurposeKnockdown of Zinc Finger MYND Type-8. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertZMYND8
ExpressionMammalianAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_ARSI_WT
Plasmid#81898PurposeGateway Donor vector containing ARSI , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only