We narrowed to 19,347 results for: EGFP
-
Plasmid#204014PurposeCloning plasmid containing the sfGFP insert with a chloramphenicol resistance markerDepositorInsertsuper folder green fluorescent protein
ExpressionPlantPromoterN/AAvailable sinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEF mito-PAcGFP
Plasmid#188905PurposeExpresses mitochondrial photoactivatable GFPDepositorInsertmitochondrial photoactivatable GFP
TagsMitochondrial leader sequence: MSVLTPLLLRGLTGSARR…ExpressionMammalianAvailable sinceOct. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
bpNLS-DddIA
Plasmid#187847Purposeexpresses the bpNLS-linked DddIA in mammalian cellsDepositorInsertbpNLS-DddIA-bpNLS-p2A-EGFP
ExpressionMammalianAvailable sinceOct. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
p09008_AF1-4+GFP5-7
Plasmid#173715PurposePlasmid backbone for the HyperXpress workflow containing new to nature hybrid GFP with strong fluorescence in E. coli cell free protein synthesis extracts.DepositorInsertshybrid GFP
mKate2
UseE. coli cell free protein synthesis extractsExpressionBacterialAvailable sinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable sinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22UbGfpnE4PCh(#301)
Plasmid#184066Purposecyclofen-inducible GFP nuclear relocation in zebrafish permanent transgenicDepositorInserteGFP-nls-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)MutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 GFP-Mpp2 KI
Plasmid#183434PurposeCreOFF knock-in for GFP-MPP2 (amino acid position: A4)DepositorInsertgRNA and GFP donor
UseCRISPRExpressionMammalianAvailable sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 GFP-Actb KI
Plasmid#183429PurposeCreOFF knock-in for GFP-beta-actin (amino acid position: before start codon)DepositorInsertgRNA and GFP donor
UseCRISPRAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 Gria1-GFP KI
Plasmid#183430PurposeCreOFF knock-in for GluA1-GFP (amino acid position: stop codon)DepositorInsertgRNA and GFP donor
UseCRISPRAvailable sinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
BicC.Ca9.R
Plasmid#168295PurposeExpresses Cas9 in Drosophila late germline cellsDepositorInsertBicC.Cas9-T2A-eGFP-p10
UseCRISPRExpressionInsectAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJF144_SECGFP_sg2
Plasmid#163865PurposesgRNA targeting GFP in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting GFP
UseCRISPRExpressionWormPromoterR07E5.16 (U6)Available sinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF143_SECGFP_sg1
Plasmid#163864PurposesgRNA targeting GFP in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting GFP
UseCRISPRExpressionWormPromoterR07E5.16 (U6)Available sinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRII-TOPO CMV-cGFP-SV40 pA + Laccase2 Exon 2
Plasmid#91802PurposeExpresses the Laccase2 circular RNA when the upstream SV40 poly(A) signal fails to be usedDepositorInsertCoral Green Fluorescent Protein (cGFP)
ExpressionMammalianPromoterCMVAvailable sinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRII-TOPO CMV-cGFP-SV40 pA + mMALAT1_3'
Plasmid#91803PurposeExpresses a cGFP mRNA that ends in the MALAT1 triple helix when the upstream SV40 poly(A) signal fails to be usedDepositorInsertCoral Green Fluorescent Protein (cGFP)
ExpressionMammalianPromoterCMVAvailable sinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
83_pAAV-ProC14-CatCh-GFP-WPRE
Plasmid#125949PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC14Available sinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
82_pAAV-ProC13-CatCh-GFP-WPRE
Plasmid#125948PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC13Available sinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
IV_pAAV-ProB6-CatCh-GFP-WPRE
Plasmid#125926PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB6Available sinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
II_pAAV-ProB5-CatCh-GFP-WPRE
Plasmid#125925PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB5Available sinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
76_pAAV-ProA25-CatCh-GFP-WPRE
Plasmid#125908PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA25Available sinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only