We narrowed to 3,249 results for: cat.3
-
Plasmid#242216PurposeExpression of MBP-tagged human ARID1A IDR2 (a.a. 1170-1610) in E. coliDepositorInsertARID1A (ARID1A Human)
TagsMBPExpressionBacterialMutationARID1A IDR2 (a.a. 1170-1610)PromotertacAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1079 - pAAV TH gRNA A EF1a EGFP
Plasmid#113159PurposeAn AAV vector that expresses guide RNA targeting rat TH and expresses EGFP reporterDepositorInsertgRNA for rat TH
UseAAV and CRISPRExpressionMammalianPromotermU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
HRas (G12V, E37G)-pcw107
Plasmid#64639Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
HRas (G12V, E37G)-pcw107-V5
Plasmid#64640Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertHRAS (transcript variant 3) (HRAS Human)
UseLentiviralTagsV5MutationG12V, E37GPromoterPGKAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA18.0 dCas9-VPR
Plasmid#138945PurposeFungal AMA1 backbone plasmid with sp-dCas9 fused to VP64-p65-Rta (VPR); ribozymes based sgRNA transcription unit; Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_dCas9m4_2xNLS-VPR; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19-HDRT-TRAC-CD19.CAR-Cas12a.PAM.mutated
Plasmid#215769Purposeencodes for HDR template for optimized AsCas12a-mediated knock-in of a CD19-specific CAR into the TRAC locusDepositorInsertsExpressionBacterialMutationCas12a PAM mutatedAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
P530_SIX6-p2A-h2b-EGFP
Plasmid#239101PurposeHuman donor plasmid for integration of p2A-h2b-EGFP into the 3' end of SIX6. This includes the donor casette and a U6 driven guide sequence to be used with Cas9.DepositorInsertSIX6 (SIX6 Human)
UseDonor plasmidTagsp2A-h2b-EGFPExpressionMammalianPromoterEndogenous SIX6 promoterAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-ARID1A-deltaARIDIDR2-FLAG
Plasmid#242214PurposeExpression of human ARID1A ∆ARID and ∆IDR2 (deletion of a.a. 971-1610) using piggyBac transpositionDepositorInsertARID1A (ARID1A Human)
UsePiggybacTagsFLAGExpressionMammalianMutationDeleted ARID and IDR2 from ARID1A (deletion of a.…PromoterCAGAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-ARID1A-deltaIDR1IDR2-FLAG
Plasmid#242213PurposeExpression of human ARID1A ∆IDR1 and ∆IDR2 (deletion of a.a. 2-970 and a.a. 1170-1610) using piggyBac transpositionDepositorInsertARID1A (ARID1A Human)
UsePiggybacTagsFLAGExpressionMammalianMutationDeleted IDR1 and IDR2 from ARID1A (deletion of a.…PromoterCAGAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only