We narrowed to 7,067 results for: FIE
-
Plasmid#253509PurposeExpression of candidate TCR #8 TCRalpha cDNADepositorInsertTRA (TRA Human)
UseLentiviralAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLX301-hTRA-candidate6
Plasmid#253513PurposeExpression of candidate TCR #6 TCRalpha cDNADepositorInsertTRA (TRA Human)
UseLentiviralAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLX301-hTRA-candidate7.1
Plasmid#253506PurposeExpression of candidate TCR #7.1 TCRalpha cDNADepositorInsertTRA (TRA Human)
UseLentiviralAvailable SinceApril 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLX301-hTRA-candidate9
Plasmid#253515PurposeExpression of candidate TCR #9 TCRalpha cDNADepositorInsertTRA (TRA Human)
UseLentiviralAvailable SinceApril 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLX301-hTRA-candidate4
Plasmid#253511PurposeExpression of candidate TCR #4 TCRalpha cDNADepositorInsertTRA (TRA Human)
UseLentiviralAvailable SinceApril 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAP114
Plasmid#247100PurposeContains Fre-L3-RebHEvo4DepositorInsertFre-L3-RebHEvo4
ExpressionBacterialMutationA16S, A32V, D101N, V256I, Q323H, N326K, T348A, T3…Available SinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGGD-ZmUBI Promoter-scFV-sfGFP
Plasmid#246802PurposeA GreenGate entry vector containing scFV-sfGFP fusion gene drived by an ZmUBI PromoterDepositorInsertZmUBI Promoter-scFV-sfGFP
UseGreengate cloning entry vectorAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_TIMM23_ER-dAPEX-BFP2
Plasmid#236734PurposeDual sgRNA targeting TIMM23 expressing dAPEX-BFP targeting to ERDepositorInsertTIMM23 (TIMM23 Human)
UseCRISPR and LentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-hU6-ZNF865-hUbC-dCas9-KRAB-eGFP
Plasmid#241308Purpose3rd gen lenti vector encoding dCas9 (s. Pyogenes) fused with the KRAB and a 2A eGFP fluorescence marker. Includes guide for suppression of the ZNF865 geneDepositorInsertZNF865 sgRNA (ZNF865 Human)
UseLentiviralAvailable SinceDec. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
M99
Plasmid#242638PurposeMYC knockdown + rescueDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_5UTR_Myc_FLuc RBM42 deletion
Plasmid#229503PurposeMyc 5' untranslated region firefly luciferase reporter with deletion of region bound by RBM42.DepositorInsertMyc 5'UTR_Del 363
ExpressionMammalianMutationDeletion of bp 363-394PromoterSV40Available SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A empty
Plasmid#213164PurposeEmpty vector (no sgRNA) for induction of global DNA methylation.DepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A-inactiveEmpty
Plasmid#213168PurposeEmpty Vector (no sgRNA) used as a negative control (inactive DNMT3A) for induction of global DNA methylation.DepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
plentiCRISPR-v2 Puro CHKA_sg2
Plasmid#218523PurposesgRNA targeting human CHKADepositorInsertCHKA (CHKA Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL69-WT(TTTT)
Plasmid#215847PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL69 with TTTT stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-EGFP12-TTTA
Plasmid#215857PurposeThis plasmid encodes sgRNA that target EGFP with stretch sequenceDepositorInsertsgRNA-EGFP12 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL69-ATTT
Plasmid#215848PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL69 with ATTT stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only