We narrowed to 14,045 results for: crispr grnas
-
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-EMX1+38
Plasmid#140579PurposeExpresses a pegRNA in mammalian cellsDepositorInsertpegRNA EMX1 +38
Available SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T3_gRNA
Plasmid#199335PurposepDEL161; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type III sgRNADepositorInsertszCREST3
Cas9
nrg1 type III sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-DNMT1+38
Plasmid#140578PurposeExpresses a pegRNA in mammalian cellsDepositorInsertpegRNA DNMT1 +38
Available SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo XLF sgRNA
Plasmid#207605PurposesgRNA for the insert of the HaloTag at the endogenous loci of XLFDepositorInsertGTTCTTCCATctgcaaaaaa
TagsNoneExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T2_gRNA
Plasmid#197647PurposepDEL160; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type II sgRNADepositorInsertszCREST3
Cas9
nrg1 type II sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T1_gRNA
Plasmid#199332PurposepDEL159; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type I sgRNADepositorInsertszCREST3
Cas9
nrg1 type I sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
SIR4 gRNA HIS
Plasmid#182520PurposeExpression vector for gRNA directed against SIR4 ORF.DepositorInsertSIR4 gRNA (SIR4 Budding Yeast)
ExpressionYeastAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
CRISPRi-CENPB-g4
Plasmid#120212PurposeCENPB CRISPRi guide RNA 4DepositorInsertCENPB CRISPRi guide RNA
UseCRISPR and LentiviralAvailable SinceApril 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
CRISPRi-CENPB-g3
Plasmid#120211PurposeCENPB CRISPRi guide RNA 3DepositorInsertCENPB CRISPRi guide RNA
UseCRISPR and LentiviralAvailable SinceApril 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
CRISPRi-CENPB-g9
Plasmid#120217PurposeCENPB CRISPRi guide RNA 9DepositorInsertCENPB CRISPRi guide RNA
UseCRISPR and LentiviralAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
CRISPRi-CENPB-g8
Plasmid#120216PurposeCENPB CRISPRi guide RNA 8DepositorInsertCENPB CRISPRi guide RNA
UseCRISPR and LentiviralAvailable SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only